ID: 1122652218

View in Genome Browser
Species Human (GRCh38)
Location 14:103232149-103232171
Sequence CCTTGGGCCTGGAGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122652206_1122652218 19 Left 1122652206 14:103232107-103232129 CCCAGAGAAGGGAGAAACCAGGG No data
Right 1122652218 14:103232149-103232171 CCTTGGGCCTGGAGCAAAACAGG No data
1122652208_1122652218 18 Left 1122652208 14:103232108-103232130 CCAGAGAAGGGAGAAACCAGGGT No data
Right 1122652218 14:103232149-103232171 CCTTGGGCCTGGAGCAAAACAGG No data
1122652212_1122652218 2 Left 1122652212 14:103232124-103232146 CCAGGGTGCGGATTGAGGGACTC No data
Right 1122652218 14:103232149-103232171 CCTTGGGCCTGGAGCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122652218 Original CRISPR CCTTGGGCCTGGAGCAAAAC AGG Intergenic
No off target data available for this crispr