ID: 1122657764

View in Genome Browser
Species Human (GRCh38)
Location 14:103273642-103273664
Sequence GGTGCGGCAGAGGCGTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122657764_1122657785 28 Left 1122657764 14:103273642-103273664 CCAGCGGACGCCTCTGCCGCACC No data
Right 1122657785 14:103273693-103273715 CCGCGGCCCTCCTAGGGCCTGGG No data
1122657764_1122657783 27 Left 1122657764 14:103273642-103273664 CCAGCGGACGCCTCTGCCGCACC No data
Right 1122657783 14:103273692-103273714 CCCGCGGCCCTCCTAGGGCCTGG No data
1122657764_1122657778 21 Left 1122657764 14:103273642-103273664 CCAGCGGACGCCTCTGCCGCACC No data
Right 1122657778 14:103273686-103273708 CCCCTTCCCGCGGCCCTCCTAGG No data
1122657764_1122657780 22 Left 1122657764 14:103273642-103273664 CCAGCGGACGCCTCTGCCGCACC No data
Right 1122657780 14:103273687-103273709 CCCTTCCCGCGGCCCTCCTAGGG No data
1122657764_1122657775 11 Left 1122657764 14:103273642-103273664 CCAGCGGACGCCTCTGCCGCACC No data
Right 1122657775 14:103273676-103273698 CCCAGCTGCGCCCCTTCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122657764 Original CRISPR GGTGCGGCAGAGGCGTCCGC TGG (reversed) Intergenic
No off target data available for this crispr