ID: 1122658011

View in Genome Browser
Species Human (GRCh38)
Location 14:103274542-103274564
Sequence GAGAATCCCCGCGGGAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658011_1122658026 29 Left 1122658011 14:103274542-103274564 CCCACGCTCCCGCGGGGATTCTC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658011 Original CRISPR GAGAATCCCCGCGGGAGCGT GGG (reversed) Intergenic
No off target data available for this crispr