ID: 1122658012

View in Genome Browser
Species Human (GRCh38)
Location 14:103274543-103274565
Sequence GGAGAATCCCCGCGGGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658012_1122658026 28 Left 1122658012 14:103274543-103274565 CCACGCTCCCGCGGGGATTCTCC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658012 Original CRISPR GGAGAATCCCCGCGGGAGCG TGG (reversed) Intergenic