ID: 1122658013

View in Genome Browser
Species Human (GRCh38)
Location 14:103274550-103274572
Sequence GGCTGCAGGAGAATCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658013_1122658030 29 Left 1122658013 14:103274550-103274572 CCCGCGGGGATTCTCCTGCAGCC No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658013_1122658026 21 Left 1122658013 14:103274550-103274572 CCCGCGGGGATTCTCCTGCAGCC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658013 Original CRISPR GGCTGCAGGAGAATCCCCGC GGG (reversed) Intergenic