ID: 1122658014

View in Genome Browser
Species Human (GRCh38)
Location 14:103274551-103274573
Sequence CGGCTGCAGGAGAATCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658014_1122658026 20 Left 1122658014 14:103274551-103274573 CCGCGGGGATTCTCCTGCAGCCG No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658014_1122658030 28 Left 1122658014 14:103274551-103274573 CCGCGGGGATTCTCCTGCAGCCG No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658014 Original CRISPR CGGCTGCAGGAGAATCCCCG CGG (reversed) Intergenic