ID: 1122658017

View in Genome Browser
Species Human (GRCh38)
Location 14:103274571-103274593
Sequence ACGAGTGGGGGGAGGGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658017_1122658030 8 Left 1122658017 14:103274571-103274593 CCGGAGCCCCTCCCCCCACTCGT No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658017_1122658026 0 Left 1122658017 14:103274571-103274593 CCGGAGCCCCTCCCCCCACTCGT No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658017_1122658032 15 Left 1122658017 14:103274571-103274593 CCGGAGCCCCTCCCCCCACTCGT No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658017_1122658035 21 Left 1122658017 14:103274571-103274593 CCGGAGCCCCTCCCCCCACTCGT No data
Right 1122658035 14:103274615-103274637 GGTCCCCAGGTGACCGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658017 Original CRISPR ACGAGTGGGGGGAGGGGCTC CGG (reversed) Intergenic