ID: 1122658018

View in Genome Browser
Species Human (GRCh38)
Location 14:103274577-103274599
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658018_1122658026 -6 Left 1122658018 14:103274577-103274599 CCCCTCCCCCCACTCGTGCCCTC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658018_1122658032 9 Left 1122658018 14:103274577-103274599 CCCCTCCCCCCACTCGTGCCCTC No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658018_1122658035 15 Left 1122658018 14:103274577-103274599 CCCCTCCCCCCACTCGTGCCCTC No data
Right 1122658035 14:103274615-103274637 GGTCCCCAGGTGACCGGCATAGG No data
1122658018_1122658030 2 Left 1122658018 14:103274577-103274599 CCCCTCCCCCCACTCGTGCCCTC No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658018 Original CRISPR GAGGGCACGAGTGGGGGGAG GGG (reversed) Intergenic