ID: 1122658019

View in Genome Browser
Species Human (GRCh38)
Location 14:103274578-103274600
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658019_1122658032 8 Left 1122658019 14:103274578-103274600 CCCTCCCCCCACTCGTGCCCTCT No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658019_1122658035 14 Left 1122658019 14:103274578-103274600 CCCTCCCCCCACTCGTGCCCTCT No data
Right 1122658035 14:103274615-103274637 GGTCCCCAGGTGACCGGCATAGG No data
1122658019_1122658030 1 Left 1122658019 14:103274578-103274600 CCCTCCCCCCACTCGTGCCCTCT No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658019_1122658026 -7 Left 1122658019 14:103274578-103274600 CCCTCCCCCCACTCGTGCCCTCT No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658019 Original CRISPR AGAGGGCACGAGTGGGGGGA GGG (reversed) Intergenic