ID: 1122658026

View in Genome Browser
Species Human (GRCh38)
Location 14:103274594-103274616
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658020_1122658026 -8 Left 1122658020 14:103274579-103274601 CCTCCCCCCACTCGTGCCCTCTT No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658013_1122658026 21 Left 1122658013 14:103274550-103274572 CCCGCGGGGATTCTCCTGCAGCC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658018_1122658026 -6 Left 1122658018 14:103274577-103274599 CCCCTCCCCCCACTCGTGCCCTC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658011_1122658026 29 Left 1122658011 14:103274542-103274564 CCCACGCTCCCGCGGGGATTCTC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658014_1122658026 20 Left 1122658014 14:103274551-103274573 CCGCGGGGATTCTCCTGCAGCCG No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658019_1122658026 -7 Left 1122658019 14:103274578-103274600 CCCTCCCCCCACTCGTGCCCTCT No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658016_1122658026 7 Left 1122658016 14:103274564-103274586 CCTGCAGCCGGAGCCCCTCCCCC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658017_1122658026 0 Left 1122658017 14:103274571-103274593 CCGGAGCCCCTCCCCCCACTCGT No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data
1122658012_1122658026 28 Left 1122658012 14:103274543-103274565 CCACGCTCCCGCGGGGATTCTCC No data
Right 1122658026 14:103274594-103274616 GCCCTCTTCCCATCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658026 Original CRISPR GCCCTCTTCCCATCAAGCCC TGG Intergenic