ID: 1122658030

View in Genome Browser
Species Human (GRCh38)
Location 14:103274602-103274624
Sequence CCCATCAAGCCCTGGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658023_1122658030 -5 Left 1122658023 14:103274584-103274606 CCCCACTCGTGCCCTCTTCCCAT No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658022_1122658030 -4 Left 1122658022 14:103274583-103274605 CCCCCACTCGTGCCCTCTTCCCA No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658024_1122658030 -6 Left 1122658024 14:103274585-103274607 CCCACTCGTGCCCTCTTCCCATC No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658016_1122658030 15 Left 1122658016 14:103274564-103274586 CCTGCAGCCGGAGCCCCTCCCCC No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658020_1122658030 0 Left 1122658020 14:103274579-103274601 CCTCCCCCCACTCGTGCCCTCTT No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658021_1122658030 -3 Left 1122658021 14:103274582-103274604 CCCCCCACTCGTGCCCTCTTCCC No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658013_1122658030 29 Left 1122658013 14:103274550-103274572 CCCGCGGGGATTCTCCTGCAGCC No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658019_1122658030 1 Left 1122658019 14:103274578-103274600 CCCTCCCCCCACTCGTGCCCTCT No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658014_1122658030 28 Left 1122658014 14:103274551-103274573 CCGCGGGGATTCTCCTGCAGCCG No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658018_1122658030 2 Left 1122658018 14:103274577-103274599 CCCCTCCCCCCACTCGTGCCCTC No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658025_1122658030 -7 Left 1122658025 14:103274586-103274608 CCACTCGTGCCCTCTTCCCATCA No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data
1122658017_1122658030 8 Left 1122658017 14:103274571-103274593 CCGGAGCCCCTCCCCCCACTCGT No data
Right 1122658030 14:103274602-103274624 CCCATCAAGCCCTGGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658030 Original CRISPR CCCATCAAGCCCTGGTCCCC AGG Intergenic