ID: 1122658032

View in Genome Browser
Species Human (GRCh38)
Location 14:103274609-103274631
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658018_1122658032 9 Left 1122658018 14:103274577-103274599 CCCCTCCCCCCACTCGTGCCCTC No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658019_1122658032 8 Left 1122658019 14:103274578-103274600 CCCTCCCCCCACTCGTGCCCTCT No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658017_1122658032 15 Left 1122658017 14:103274571-103274593 CCGGAGCCCCTCCCCCCACTCGT No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658022_1122658032 3 Left 1122658022 14:103274583-103274605 CCCCCACTCGTGCCCTCTTCCCA No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658025_1122658032 0 Left 1122658025 14:103274586-103274608 CCACTCGTGCCCTCTTCCCATCA No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658023_1122658032 2 Left 1122658023 14:103274584-103274606 CCCCACTCGTGCCCTCTTCCCAT No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658020_1122658032 7 Left 1122658020 14:103274579-103274601 CCTCCCCCCACTCGTGCCCTCTT No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658016_1122658032 22 Left 1122658016 14:103274564-103274586 CCTGCAGCCGGAGCCCCTCCCCC No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658024_1122658032 1 Left 1122658024 14:103274585-103274607 CCCACTCGTGCCCTCTTCCCATC No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658021_1122658032 4 Left 1122658021 14:103274582-103274604 CCCCCCACTCGTGCCCTCTTCCC No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658027_1122658032 -9 Left 1122658027 14:103274595-103274617 CCCTCTTCCCATCAAGCCCTGGT No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data
1122658028_1122658032 -10 Left 1122658028 14:103274596-103274618 CCTCTTCCCATCAAGCCCTGGTC No data
Right 1122658032 14:103274609-103274631 AGCCCTGGTCCCCAGGTGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658032 Original CRISPR AGCCCTGGTCCCCAGGTGAC CGG Intergenic