ID: 1122658573

View in Genome Browser
Species Human (GRCh38)
Location 14:103279225-103279247
Sequence GCTGCTGGGGAGCGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 1090}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658558_1122658573 6 Left 1122658558 14:103279196-103279218 CCCGCGCCCCGCCAGGGCTGCCG No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658559_1122658573 5 Left 1122658559 14:103279197-103279219 CCGCGCCCCGCCAGGGCTGCCGG No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658555_1122658573 19 Left 1122658555 14:103279183-103279205 CCTGCGGGCTGGTCCCGCGCCCC No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658553_1122658573 25 Left 1122658553 14:103279177-103279199 CCGGACCCTGCGGGCTGGTCCCG No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658566_1122658573 -5 Left 1122658566 14:103279207-103279229 CCAGGGCTGCCGGGGTGTGCTGC No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658554_1122658573 20 Left 1122658554 14:103279182-103279204 CCCTGCGGGCTGGTCCCGCGCCC No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658563_1122658573 0 Left 1122658563 14:103279202-103279224 CCCCGCCAGGGCTGCCGGGGTGT No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658564_1122658573 -1 Left 1122658564 14:103279203-103279225 CCCGCCAGGGCTGCCGGGGTGTG No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658552_1122658573 26 Left 1122658552 14:103279176-103279198 CCCGGACCCTGCGGGCTGGTCCC No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090
1122658565_1122658573 -2 Left 1122658565 14:103279204-103279226 CCGCCAGGGCTGCCGGGGTGTGC No data
Right 1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG 0: 1
1: 0
2: 4
3: 58
4: 1090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658573 Original CRISPR GCTGCTGGGGAGCGTGGAGT GGG Intergenic
900113264 1:1018524-1018546 GCGGCTGCGGAGGGTGTAGTGGG - Intergenic
900504881 1:3024969-3024991 GCTGCTGGGGGCGGTGGGGTGGG + Intergenic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
900655980 1:3757551-3757573 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
900793795 1:4695486-4695508 GCTCCAGGGGAGAGTGGAGATGG + Intronic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
901065832 1:6494061-6494083 GCTACTGGGGAGGGTGAGGTGGG - Intronic
901088498 1:6626196-6626218 GCTGCTCGGGAGACTGAAGTAGG + Intronic
901336491 1:8453692-8453714 GCTACTGGGGAGGCTGAAGTGGG + Intronic
901552015 1:10002609-10002631 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
901645835 1:10716276-10716298 GGTGCTGTGGAGTGTGGATTGGG - Intronic
901677785 1:10897078-10897100 GCTGCCGGGGAGGGTTGGGTGGG - Intergenic
901801673 1:11711832-11711854 CCTGCTGGAGACCGTGGAGAAGG - Exonic
901932911 1:12608411-12608433 GGTGCTGGGGAGCAGGGAGGAGG - Intronic
902078016 1:13802911-13802933 GCTGCAGGGGAGCGTGTGATGGG + Intronic
902215496 1:14932052-14932074 GCTGGTGGGCAGCCTGGAGCCGG - Intronic
902321878 1:15673652-15673674 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
902523480 1:17037411-17037433 GCTACTTGGGAGGGTGGGGTGGG - Intronic
903029548 1:20453100-20453122 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
903163806 1:21507462-21507484 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
903636452 1:24821071-24821093 GCTACTGGGGAGCCTGAGGTGGG + Intronic
903639743 1:24850053-24850075 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
903710310 1:25318474-25318496 GCTACTGGGGAGGCTGAAGTAGG + Intronic
904119280 1:28186087-28186109 GCTACTGGGGAGGCTGGGGTGGG - Intronic
904219867 1:28958334-28958356 GCTACTGGGGAGACTGAAGTGGG + Intronic
904338854 1:29819508-29819530 GCTACTGGGGAGGCTGAAGTAGG - Intergenic
904482573 1:30803229-30803251 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
904545572 1:31268392-31268414 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
904711134 1:32431207-32431229 GCTACTGGGGAGGCTGAAGTAGG + Intergenic
904718045 1:32484094-32484116 GCTGCTTGGGAGGCTGGAGGGGG + Intronic
905158498 1:36010048-36010070 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
905383753 1:37584335-37584357 GCTACTGGGGAGACTGGGGTGGG + Intronic
905532660 1:38694495-38694517 TCTGTTGGGGAGGATGGAGTGGG - Intergenic
905559141 1:38912520-38912542 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
905896295 1:41547924-41547946 GGTGCTAGGGAGGCTGGAGTGGG - Intronic
906352038 1:45069312-45069334 GCTACTGGGGAGGCTGAAGTAGG + Intronic
906903609 1:49864857-49864879 GCTGCTGGGGCGAGGGGAGGCGG + Intronic
907041746 1:51267125-51267147 GCTACTGGGGAGGCTGCAGTGGG + Intronic
907073631 1:51559299-51559321 GTTGCGGGGGATGGTGGAGTAGG + Intergenic
907425387 1:54376045-54376067 GCTCCTGGGTACTGTGGAGTGGG - Intronic
907538207 1:55185068-55185090 GCTGCTGGGGAGCTGGGAAGTGG - Intronic
908210857 1:61898350-61898372 GCTACTGGGGAGGCTGGAGCAGG - Intronic
908361990 1:63377843-63377865 GCTACTGGGGAGGCTGGAGCAGG - Intronic
908408385 1:63837707-63837729 GCTACTTGGGAGGCTGGAGTAGG + Intronic
908543915 1:65146921-65146943 TATGCAGGGGAGGGTGGAGTGGG + Intergenic
908721332 1:67129342-67129364 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
908878656 1:68706372-68706394 GGGGATGGGGAGGGTGGAGTGGG + Intergenic
909177876 1:72382945-72382967 GCTACTTGGGAGGGTGGGGTGGG - Intergenic
909248020 1:73313607-73313629 GCTACTGGGGAAGGTGAAGTAGG - Intergenic
909367264 1:74841347-74841369 GCTACTTGGGAGGCTGGAGTGGG + Intergenic
910204566 1:84735285-84735307 GCTACTGGGGAGCGTGAAGCAGG + Intergenic
910449238 1:87329496-87329518 GCTGGTGGGGACCGTAGAGGGGG + Intronic
910921584 1:92354057-92354079 GCTGCTTGGGATAGTGAAGTTGG - Intronic
910995719 1:93102478-93102500 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
911724975 1:101233615-101233637 GCTGCTTGGGAGGCTGAAGTAGG + Intergenic
912492837 1:110071258-110071280 GGTGCTGGGGAGCTTGGACCTGG + Intronic
912798903 1:112708847-112708869 GCTGCTGGGGAAGCTGAAGTGGG - Intronic
913252008 1:116919507-116919529 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
913295188 1:117312376-117312398 GATGCTGTGGTGGGTGGAGTGGG - Intergenic
913320141 1:117582296-117582318 GCTGATGGGGTGGGTGGACTGGG + Intergenic
913534110 1:119755126-119755148 GCTGCTCGGGAGGCTGAAGTGGG - Intronic
914395495 1:147263316-147263338 GCTACTGGGGAGGCTGAAGTGGG + Intronic
914824595 1:151132210-151132232 GCTGGAAGGGAGCGGGGAGTGGG + Exonic
914874312 1:151501392-151501414 GCTACTGGGGAGGGTGAAGCAGG + Intergenic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
915073678 1:153292462-153292484 GCTGCGGGGGTGCTGGGAGTGGG - Intergenic
915425727 1:155825050-155825072 GTTGCTGGGGAGGCTGAAGTGGG + Intronic
915442044 1:155951359-155951381 GCTCCTGGAGAGCTTGGATTGGG + Intronic
915609657 1:156981139-156981161 GCTACTTGGGAGGGTTGAGTTGG - Intronic
916161109 1:161915734-161915756 GCTGCTCGGGAGGCTGAAGTGGG - Intronic
916256097 1:162789639-162789661 GCTACTGGGGAGTGGGGAGATGG + Intergenic
917050215 1:170914467-170914489 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
917181455 1:172302359-172302381 GCAGCTGGGAAGCTTGAAGTGGG + Intronic
917430109 1:174957661-174957683 GCTACTTGGGAGACTGGAGTGGG - Intronic
917837344 1:178951965-178951987 GCTGCATGTGAGCGTGGAGCAGG + Intergenic
917845386 1:179015910-179015932 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
917937245 1:179880999-179881021 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
917983766 1:180294004-180294026 GCTGCTCGGGAGCCTGAAGCAGG - Intronic
918104711 1:181406759-181406781 TCAGTTGGTGAGCGTGGAGTTGG + Intergenic
918384030 1:183986901-183986923 TGTGGTGGGGAGCCTGGAGTGGG - Intronic
918533850 1:185552672-185552694 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
919682105 1:200445812-200445834 GCTGCTTGGGAGGCTGGGGTGGG - Intergenic
919875652 1:201865318-201865340 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
919930427 1:202217672-202217694 GCTGGAGGGGTGCCTGGAGTGGG - Intronic
920872360 1:209805383-209805405 GGTGCTGGGGAGGGTGGCGCTGG - Intronic
921056075 1:211543465-211543487 GCTACTGGGGAGGTTGAAGTGGG - Intergenic
921293846 1:213683744-213683766 ACAGGTGGGGAACGTGGAGTTGG - Intergenic
921610785 1:217209915-217209937 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
921871601 1:220146404-220146426 TCTGCTGGGGAGGCTGGGGTGGG + Intronic
922313023 1:224414215-224414237 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
922316622 1:224448123-224448145 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
922465005 1:225840377-225840399 GCTGCAGGGGAGAGGGGAGAGGG + Intronic
923289201 1:232527841-232527863 GCTGCTTGGGAGAGTGAAGTGGG - Intronic
923854139 1:237827823-237827845 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
924083902 1:240428341-240428363 GCTACTTGGGAGGGTGGGGTGGG - Intronic
924567906 1:245213242-245213264 GCTGGTGGGGGGCCTGGAGAGGG + Intronic
1062803174 10:395094-395116 GCTGGGGGGGAGGGAGGAGTTGG + Intronic
1063169908 10:3499639-3499661 GCTAGTGGGGAGCCTGAAGTGGG - Intergenic
1063208390 10:3856126-3856148 GCTGCTGGGGAGGTTGAGGTGGG + Intergenic
1063621805 10:7656324-7656346 GCTGCTTGGGAGGTTGAAGTCGG - Intronic
1063623445 10:7667917-7667939 GTTGCGGGGGCGCGTGGGGTAGG - Intergenic
1063632791 10:7749746-7749768 GCTGCTAGGGAGGTTGAAGTGGG - Intergenic
1063643999 10:7860158-7860180 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1063702120 10:8394729-8394751 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1064025317 10:11844101-11844123 GCTGCTGGGGAGGCTGCAGTGGG - Intronic
1064140593 10:12787009-12787031 GCTGCTGGGGAGACTGAGGTGGG + Intronic
1064191612 10:13211340-13211362 GCTGCTCGGGAGGCTGAAGTGGG - Intergenic
1064445576 10:15389821-15389843 GCTACTTGGGAGGCTGGAGTGGG + Intergenic
1064568712 10:16670874-16670896 GCTACTGGGGAGGCTGGAGCAGG - Intronic
1064681099 10:17811679-17811701 GCTACTGGGGAGTTGGGAGTGGG - Intronic
1064709892 10:18112267-18112289 GCTGCAGGGGAGAGGGGACTTGG - Intergenic
1064956039 10:20911050-20911072 GCTGCTCGGGAGGATGAAGTGGG + Intronic
1065140370 10:22714083-22714105 GCTGCTGCGGGGCGGGGAGCCGG - Intronic
1065188187 10:23189230-23189252 GCAGTTGGGGAGCCTGGAGAGGG - Intergenic
1065350733 10:24793559-24793581 GCTACTGGGGAGGTTGAAGTGGG + Intergenic
1065424329 10:25583285-25583307 GCTGCTGGGAAGCAGGTAGTTGG - Intronic
1065715888 10:28567864-28567886 GCTACTTGGGAGGCTGGAGTGGG - Intronic
1066105574 10:32154152-32154174 GCTACTTGGGAGGGTGAAGTGGG - Intergenic
1066254780 10:33667915-33667937 TAAGCTGGGGAGCGTGGACTGGG - Intergenic
1066312528 10:34211666-34211688 GCTACTGGGGAGCGTGAGGCAGG + Intronic
1066668307 10:37809387-37809409 GCTGCTTAGGAGCCTGCAGTGGG - Intronic
1066722559 10:38355293-38355315 GCTACTGGGGAGTGGGGAGATGG + Intergenic
1067098435 10:43317547-43317569 GCTGCTGGGGAGAGGGGATGCGG - Intergenic
1068261453 10:54588685-54588707 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1068818576 10:61346291-61346313 GATGCTGGGGAGCATGTAATGGG - Intergenic
1068986281 10:63110458-63110480 GCTACTGGGGAGCCTGAGGTGGG - Intergenic
1069093456 10:64229712-64229734 GCTGCTGGGAAGTTTGGACTGGG - Intergenic
1069409732 10:68140958-68140980 GCTACTTGGGAGGCTGGAGTGGG + Intronic
1069699987 10:70416774-70416796 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1069886985 10:71630131-71630153 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1069995412 10:72339153-72339175 GCTACTGGGGAGCCTGAGGTGGG + Intronic
1070031962 10:72685742-72685764 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1070158286 10:73850105-73850127 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1070218292 10:74410567-74410589 GCTGCTGGGGAGGCTGAGGTAGG + Intronic
1070221290 10:74448205-74448227 GCTACTTGGGAGGGTGAAGTGGG + Intronic
1070280693 10:75046002-75046024 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1070555922 10:77527725-77527747 GCTGGTGGGGAGTGAGGAGGAGG + Intronic
1070796235 10:79218361-79218383 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1070908900 10:80100370-80100392 GCTGCTTGGGAGGCTGCAGTGGG + Intergenic
1071129857 10:82378187-82378209 GATGTTGGGGAGTGTGGAGGAGG - Intronic
1071211823 10:83350123-83350145 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1071594317 10:86908090-86908112 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1072081813 10:92040247-92040269 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1072254979 10:93612917-93612939 GCTGCTGTGGACCGTGCAGGAGG + Exonic
1072297069 10:94019451-94019473 GGTGATGGGGAGGGTGGACTGGG - Intronic
1072691998 10:97578145-97578167 GCTGGTGGGGAGGGTGGGGTGGG - Intronic
1072742747 10:97919849-97919871 GCTACTTGGGAGGCTGGAGTGGG - Intronic
1072918621 10:99556740-99556762 GCTACTTGGGAGGCTGGAGTGGG + Intergenic
1072976797 10:100065820-100065842 GATGGTGGGGTGGGTGGAGTGGG + Intronic
1073292878 10:102421921-102421943 GCAGCTGCGGAGTGTGGCGTTGG + Exonic
1073343643 10:102765342-102765364 GTTGCTGGGGAGGGTGAGGTAGG - Intronic
1073427039 10:103461299-103461321 GCTGCTCAGGAGCCTGAAGTGGG - Intergenic
1073450473 10:103606319-103606341 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1073504980 10:103977501-103977523 GCTGCTGGAGAGGCTGAAGTGGG + Intronic
1073561549 10:104501291-104501313 GCTGAGGGGTAGGGTGGAGTTGG - Intergenic
1073777293 10:106800631-106800653 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1074273575 10:111979262-111979284 GGGGCTGGAGAGCGTGGAGTCGG - Intergenic
1074515146 10:114160156-114160178 GCTACTTGGGAGCCTGAAGTAGG + Intronic
1074531605 10:114302218-114302240 GCTGCTGGGCAGAGTGGGGTGGG + Intronic
1075291721 10:121236696-121236718 CATGCTGAGGAGCCTGGAGTTGG - Intergenic
1075417239 10:122273634-122273656 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1076038696 10:127224606-127224628 GCTGCTTGGGAGCCTGAGGTAGG + Intronic
1076514198 10:131033925-131033947 GCTCCTGGGGAATGTGGAGCAGG + Intergenic
1076783358 10:132736668-132736690 GCTGCTGGGCAGCCTGGCCTTGG - Intronic
1076997738 11:307173-307195 GCTGCTGGGCTGTGTGGAGCGGG + Intergenic
1077324836 11:1959231-1959253 GCTGCAGAGGAGCGCGGAGCAGG + Intronic
1078158959 11:8824012-8824034 GCTACTGGGGAGCCTGAAGCAGG - Intronic
1078183352 11:9030612-9030634 CCTGCTGGGGCGAGTGGAGCTGG + Intronic
1078200630 11:9179609-9179631 GCTACTGGGGAGGGTGAGGTAGG - Intronic
1078287885 11:9976483-9976505 GCTACTTGGGAGCGTGAGGTGGG + Intronic
1078476042 11:11631126-11631148 GCTACTCGGGAGGGTGAAGTGGG + Intergenic
1079122815 11:17697282-17697304 ACTGCTGGGGAGCCTGGTGTGGG - Intergenic
1079125593 11:17716588-17716610 GCTGCTGGGGAGTTTGAAGCAGG + Intergenic
1079207614 11:18430471-18430493 GCTACTGGGGAGCCTGAGGTGGG - Intronic
1079489515 11:20972018-20972040 CCTGCTGGGGAGCGGGGTGGGGG + Intronic
1080510395 11:32964082-32964104 GCTGCTTGGGGGCCTGAAGTAGG - Intronic
1080620409 11:33982482-33982504 GCTACTGGGGAGGCTGAAGTTGG - Intergenic
1080713001 11:34769489-34769511 GCTGCTGGGGGGAGGGGGGTGGG - Intergenic
1080886873 11:36376174-36376196 CCTGCTGGGGAGAGCGGAGAGGG - Intronic
1081092275 11:38887229-38887251 GCTACTGGGGAGGGTGAAGTGGG - Intergenic
1081576707 11:44323168-44323190 GCTGCTGGGGAGAAGGGAGAAGG - Intergenic
1082055649 11:47813712-47813734 GCTGCTAGGGAGGCTGGGGTGGG + Intronic
1082913810 11:58408702-58408724 TCTGCTTGGGAGTGTGGTGTGGG - Intergenic
1082988330 11:59186460-59186482 CCTGCTGGGGAGCTGGGAGCAGG + Intronic
1083201614 11:61124207-61124229 GCTGCTGGGGACCCTAGAGATGG - Intronic
1083327885 11:61882529-61882551 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1083373439 11:62200561-62200583 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1083595815 11:63917811-63917833 GCTGCAGGGGAGAGAGGAGCTGG + Intergenic
1083615560 11:64024442-64024464 GCAGCTGGGGAGTGGGGAGCTGG + Intronic
1083662371 11:64257503-64257525 GCTGCTTGGGAGGGTGAGGTGGG + Intronic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1083961475 11:66017122-66017144 GCTGGTGGCAAGCGTGGAGCAGG - Exonic
1084113217 11:67026725-67026747 GCTACTGGGGAGGCTGGTGTGGG - Intronic
1084614552 11:70226862-70226884 GCTGCATGTGTGCGTGGAGTGGG - Intergenic
1084698663 11:70771520-70771542 GCAGCTGGGCTGGGTGGAGTGGG + Intronic
1084970930 11:72771705-72771727 GCTGCTCTGGAGCCTGGAGGTGG - Intronic
1085251209 11:75145089-75145111 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1086099195 11:83081623-83081645 GCTACTCGGGAGGGTGGGGTGGG - Intergenic
1088239019 11:107754997-107755019 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1088343824 11:108800047-108800069 GCTGCTCGGGAGGCTGAAGTGGG - Intronic
1088355807 11:108942701-108942723 GCTGCTTGGGAGGCTGTAGTGGG + Intergenic
1088455721 11:110030951-110030973 GGTCCTGGGGAGGGGGGAGTTGG - Intergenic
1088485415 11:110335610-110335632 GCTGCTTGGGAGGCTGAAGTAGG + Intergenic
1088598137 11:111455055-111455077 GCTTCTGAGGAGCGTGCAGAGGG + Exonic
1089209482 11:116790724-116790746 GTTGCTGGGGGGCGTGGACGAGG - Exonic
1089584999 11:119504718-119504740 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
1090491686 11:127168705-127168727 GTTGCTGGAGAGCCTGGGGTGGG + Intergenic
1090696595 11:129250103-129250125 GCTGCTCAGGAGGGTGAAGTGGG + Intronic
1090923352 11:131228113-131228135 GCTACTTGGGAGGGTGAAGTGGG - Intergenic
1202807816 11_KI270721v1_random:14408-14430 GCTGCAGAGGAGCGCGGAGCAGG + Intergenic
1091462359 12:654081-654103 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1091468791 12:708862-708884 GCTGCTGGGGGGCCTGAGGTGGG - Intergenic
1091648817 12:2294365-2294387 GCTGCTGAGGAAGGTGGAGCTGG + Intronic
1092020037 12:5194065-5194087 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
1092154313 12:6272578-6272600 GTTGCTGGGGAATATGGAGTTGG - Intergenic
1092720608 12:11436873-11436895 GCTACTGGGGAGGGTGAGGTGGG + Intronic
1093532008 12:20176814-20176836 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1093935365 12:24994978-24995000 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1094111397 12:26866462-26866484 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1094576676 12:31693187-31693209 GCTGCTCAGGAGTCTGGAGTGGG - Intronic
1094626140 12:32125935-32125957 GCTGCTCGGGAGCCTGAGGTGGG + Intronic
1095743196 12:45629050-45629072 GCTGCTTGGGAGCCTGGGGCAGG + Intergenic
1095816800 12:46431513-46431535 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1096164109 12:49406394-49406416 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1096218160 12:49809700-49809722 GCTGCTGAGGAGTGTGGGGAGGG + Intronic
1096219900 12:49822656-49822678 GCTACTGGGGAGCCTGAGGTGGG - Intronic
1096290977 12:50343101-50343123 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1096346193 12:50848974-50848996 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1096363471 12:51008091-51008113 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1096503401 12:52079158-52079180 CCTGCTGTGGAGTGTGGAGGAGG + Intergenic
1096543480 12:52321629-52321651 ACTGCTGTGGAGCGGGGAGAGGG + Intergenic
1096557491 12:52412292-52412314 GCTTCTGGTGGGCGTGGACTTGG - Intergenic
1096724322 12:53548871-53548893 GCTACTGGGGAGGGTGAGGTGGG + Intronic
1096785874 12:54017046-54017068 GCAGCTGGGGAGGGTGGGGATGG + Intronic
1096970912 12:55665596-55665618 GCTGCTTGGGAGGTTGAAGTGGG + Intergenic
1096990838 12:55801329-55801351 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1097430974 12:59506580-59506602 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1097728183 12:63098614-63098636 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1098139645 12:67438497-67438519 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1098985154 12:77004314-77004336 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1099378338 12:81922152-81922174 GCTACTGGGGAGGGTGAGGTGGG + Intergenic
1100164057 12:91895990-91896012 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1100347160 12:93743441-93743463 GGTGCTGGGGAGGCTGAAGTGGG - Intronic
1100447833 12:94677567-94677589 GCTGCTCGGGAGACTGGGGTGGG + Intergenic
1100631987 12:96399438-96399460 GCGGGTGGGGAGCGCGGAGGAGG - Intronic
1100659596 12:96682485-96682507 GCTGCTTGGGAGACTGAAGTGGG - Intronic
1101340925 12:103841293-103841315 GCCGCTGCGGGGCGGGGAGTGGG + Intergenic
1101348762 12:103908581-103908603 GCTGCTGGGGAGTCTGAGGTGGG + Intergenic
1101421468 12:104554619-104554641 ACTGCTGGGGAGGATGGAGGAGG + Intronic
1101504909 12:105337210-105337232 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1101529605 12:105562176-105562198 GGTGCTGGGGAGTATGGAGGGGG + Intergenic
1101886861 12:108671872-108671894 GCTGCTTGGGAGCCTGAGGTGGG - Intronic
1101919045 12:108918001-108918023 GCTGCTGGGGAACGGGCAGTGGG - Intronic
1101958265 12:109229346-109229368 GCTGCTTGTGCACGTGGAGTGGG + Intronic
1101963299 12:109265652-109265674 TTTGCTGGGGAGCGGGGAGGGGG - Intronic
1102078217 12:110076786-110076808 GCTGCTTGGGAGGCTGGGGTAGG - Intergenic
1102130314 12:110523313-110523335 GCTGCTGAGGAGGTTGAAGTGGG + Intronic
1102287025 12:111665952-111665974 GCTACTGGGGAGCCTGAGGTGGG - Intronic
1102481054 12:113223653-113223675 GCTACTGGGGAGCCTGAAGCAGG - Intronic
1102692833 12:114774857-114774879 GTAGCTGGGGAGCGTGGAGGGGG - Intergenic
1102846779 12:116193197-116193219 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1102866899 12:116381884-116381906 GATGCTGGGGAGAGGGGAGTTGG - Intergenic
1102955568 12:117056482-117056504 GCTGCTGGGGAGGCTGCGGTGGG - Intronic
1103229692 12:119318777-119318799 GTGGGTGGGGAGGGTGGAGTAGG + Intergenic
1103281709 12:119763330-119763352 GCTGCTTGGGAGCCTGAGGTGGG - Intronic
1103446565 12:120999037-120999059 GATGCAGGGGAGCCTGGAGGAGG - Intronic
1103548142 12:121716194-121716216 GCTACTAGGGAGGCTGGAGTAGG + Intronic
1103570660 12:121842535-121842557 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1103576136 12:121878783-121878805 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1103788250 12:123449743-123449765 GCTGCTCGGGAGGCTGAAGTGGG + Intergenic
1103912079 12:124357398-124357420 GCTACTTGGGAGCCTGAAGTGGG - Intronic
1103978939 12:124723451-124723473 GCTGCTGGGCATCCTGGATTAGG - Intergenic
1104009238 12:124917438-124917460 GCAGCTGGGGAGGGCGGGGTTGG + Intergenic
1104301539 12:127569377-127569399 GCTGCTAGGGTGCCTGGAGGGGG - Intergenic
1104551193 12:129759043-129759065 GCTACTGGGGAGACTGAAGTAGG - Intronic
1104598221 12:130134265-130134287 GGTGCTGGGGAGGGAGGAGCTGG - Intergenic
1104650350 12:130526931-130526953 GCTGGTGGGAAGCCTGGAGAGGG + Intronic
1105295134 13:19082234-19082256 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1105410451 13:20167410-20167432 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1105411899 13:20177705-20177727 GCTGCTGGGCAGCGAGGCCTGGG - Intergenic
1105513243 13:21068738-21068760 GCTGCTGGGGAGACTGAGGTAGG - Intergenic
1105650297 13:22370099-22370121 GCTCCTGGGGAGCCTGGGGATGG - Intergenic
1106044102 13:26121541-26121563 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
1106522210 13:30507745-30507767 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1107812895 13:44217176-44217198 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1107991450 13:45822113-45822135 GATGCTGGGGAGCTTGGACTGGG - Intronic
1108651213 13:52481665-52481687 GCTACTGGGGAGCCTGAGGTAGG + Intergenic
1109295484 13:60525283-60525305 GCTACTCGGGAGGGTGAAGTGGG - Intronic
1110572827 13:77025599-77025621 GCTACTAGGGAGCCTGGGGTGGG + Intronic
1110874362 13:80490775-80490797 GCGGCTGCGGAGGGTGTAGTGGG - Intergenic
1112197007 13:97236012-97236034 GAGGCTGGGGAGGGTGGAGAAGG + Intronic
1112489873 13:99852348-99852370 GCTGCTTGGGAGGCTGCAGTGGG - Intronic
1113728987 13:112626187-112626209 GCTGCTGGGGAGGCTGCAGAAGG + Intergenic
1113935731 13:113994722-113994744 GCTACTTGGGAGAGTGAAGTGGG + Intronic
1114040516 14:18674034-18674056 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1114045553 14:18872547-18872569 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1114118659 14:19646921-19646943 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1114185912 14:20402068-20402090 GCTACTCGGGAGGGAGGAGTAGG + Intronic
1114315398 14:21505195-21505217 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1115271928 14:31562176-31562198 GCTTCTGGAAAGGGTGGAGTCGG + Exonic
1115524413 14:34265463-34265485 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1115965571 14:38884032-38884054 GCTGCAGGGTAGAATGGAGTGGG - Intergenic
1116426603 14:44798925-44798947 GCGGCGGGGGAGCGGGGAGGCGG - Intergenic
1116969984 14:51054171-51054193 GCTGCTGGGGAGACTGAGGTGGG - Intronic
1117442233 14:55770892-55770914 GCTGCTAGGGAGGCTGAAGTGGG + Intergenic
1117499367 14:56337001-56337023 TCTGCAGGGGAGCGTGCAGGAGG - Intergenic
1117801572 14:59449223-59449245 GCGGCGGGGGAACGTAGAGTGGG - Intronic
1117915420 14:60673090-60673112 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1117957479 14:61133777-61133799 GCGGCGGGGGAACGTAGAGTGGG + Intergenic
1118582915 14:67322234-67322256 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1118712187 14:68529306-68529328 GCTGCTGGGGAGGCTGATGTGGG - Intronic
1118830833 14:69430740-69430762 GCTGCTGGAGAGGCTGAAGTGGG - Intronic
1119133600 14:72196450-72196472 GTTGCTGTGGTGCATGGAGTGGG + Intronic
1119270661 14:73301547-73301569 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1119272009 14:73314586-73314608 GCTACTCAGGAGCCTGGAGTGGG - Intronic
1119407845 14:74409757-74409779 GCTGCTGGGGAGGGGGGCCTGGG + Exonic
1119462376 14:74817942-74817964 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1119527033 14:75330967-75330989 GGTGCTGGGGAGTGTGAGGTTGG + Intergenic
1119531218 14:75362617-75362639 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1120034244 14:79678146-79678168 GCTGCAGGGGCCAGTGGAGTAGG - Intronic
1120758970 14:88269546-88269568 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1120909278 14:89651012-89651034 GCTACTTGGGAGGCTGGAGTTGG + Intergenic
1121203515 14:92140800-92140822 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1121652214 14:95566838-95566860 GCTGCTAGGGAGGCTGGGGTAGG + Intergenic
1121663606 14:95654593-95654615 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1122464438 14:101921177-101921199 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1122492002 14:102123910-102123932 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1122647978 14:103207491-103207513 GCTGCTGGGGAGCGTGACGTGGG + Intergenic
1122658573 14:103279225-103279247 GCTGCTGGGGAGCGTGGAGTGGG + Intergenic
1122670464 14:103367785-103367807 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1122675947 14:103413532-103413554 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1122755253 14:103973558-103973580 GCTGCCGGGGAGGGTGGATGAGG + Intronic
1122909460 14:104820099-104820121 GCTACTGGGGAGGGTGAGGTGGG - Intergenic
1123691247 15:22840030-22840052 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1124016979 15:25885880-25885902 GCTGCTGGGGAGGCTGAGGTAGG - Intergenic
1124957046 15:34366717-34366739 GCTGCAGGGGACCCTGGGGTTGG - Intronic
1125071012 15:35552925-35552947 GCTACTTGGGAGGGTGAAGTGGG + Intergenic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1125702960 15:41704544-41704566 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
1125725952 15:41868243-41868265 TCAGCTGGGGAGGGTGGTGTGGG + Intronic
1125768119 15:42148521-42148543 GCTGCTGGGGAAAGGGGAGGTGG - Intronic
1125999839 15:44198210-44198232 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1126586089 15:50288935-50288957 GCTACTTGGGAGCCTGGAGTGGG - Intronic
1126629257 15:50717284-50717306 GCTGCTCGGGAGCCTGAGGTGGG - Intronic
1127104565 15:55599166-55599188 GCTGCTTGGGAGACTGGGGTGGG + Intergenic
1127626814 15:60787927-60787949 GCTGCTGGGGATACTGCAGTGGG + Intronic
1127714905 15:61640541-61640563 GGGGCTGGGGAGGGTGGGGTGGG + Intergenic
1127941841 15:63705916-63705938 GCTACTTGGGAGGCTGGAGTAGG + Intronic
1128008654 15:64269913-64269935 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1128115372 15:65101994-65102016 GATGCAGGAGCGCGTGGAGTAGG + Intronic
1128459917 15:67859341-67859363 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1128748951 15:70134827-70134849 GCTGCTGGGGTAGCTGGAGTAGG - Intergenic
1129144708 15:73636231-73636253 GCTACTCGGGAGGGTGAAGTAGG - Intergenic
1129413272 15:75361285-75361307 GATGCAGGGCAGCGTGGAGGAGG - Exonic
1129678940 15:77647085-77647107 GGGGCTGGGGAGTGTGGGGTGGG + Intronic
1130051946 15:80490968-80490990 GGTGGTGGGGAGAGTGGAGCAGG + Intronic
1130385465 15:83407375-83407397 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1130707415 15:86246346-86246368 GTTGCTGGGGAGCCTGGAGGTGG + Intronic
1130860165 15:87878678-87878700 GCTGCTATGGTGGGTGGAGTGGG + Intronic
1130965194 15:88692111-88692133 GCTACTAGGGAGGGTGAAGTGGG + Intergenic
1131102093 15:89700672-89700694 GCTACTTGGGAGGGTGGGGTGGG - Intronic
1131187396 15:90286394-90286416 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1131195625 15:90352452-90352474 GCTGCTGAGGGGCGTGGAGGGGG + Intronic
1131506584 15:93025181-93025203 GCTGATGGGGAGTGGCGAGTTGG + Exonic
1131679870 15:94710057-94710079 GCTACTGGGGAGGCTGAAGTAGG + Intergenic
1132030478 15:98434869-98434891 GCTACTGGGGAGGCTGTAGTGGG + Intergenic
1132042721 15:98538534-98538556 GCTGCTGGGAAGCTGGGATTGGG - Intergenic
1132393331 15:101454606-101454628 GCTGTGGGGGAGGGAGGAGTGGG + Intronic
1132702480 16:1228009-1228031 GCTCGTGGGAAGCGTGGGGTAGG + Intronic
1132705844 16:1242859-1242881 GCTCGTGGGAAGCGTGGGGTAGG - Intergenic
1132748430 16:1446527-1446549 ACTGCTGGGGAGCATGGTTTGGG + Exonic
1132771556 16:1566571-1566593 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1132819554 16:1856873-1856895 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1133096714 16:3452099-3452121 GCTACTGGGGAGGGTGAGGTGGG + Intronic
1133119871 16:3599409-3599431 GCAGCAGGGCAGCGTGGAGCAGG + Intronic
1133205759 16:4232620-4232642 GCTGCTTGGGAGGCTGGAGCAGG - Intronic
1133639055 16:7699301-7699323 GCTACTAGGGAGGGTGAAGTGGG - Intronic
1133735924 16:8615762-8615784 GCTACTGGGGAGGGTGAAATGGG - Intergenic
1133834878 16:9358977-9358999 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
1134132695 16:11660299-11660321 GCTGCTTGGGAGGCTGAAGTAGG - Intergenic
1134461136 16:14430198-14430220 GCTACTTGGGAGGGTGAAGTGGG + Intergenic
1134485535 16:14655543-14655565 GCTGCTGGTGAGGCTGGGGTAGG - Intronic
1134572369 16:15302199-15302221 GCTACTGGGGAGGCTGAAGTAGG - Intergenic
1134761242 16:16717040-16717062 GCTACTGGGGAGGGTGAGGTGGG + Intergenic
1134767603 16:16774505-16774527 GCTGCTGGGAAGCTTGAACTGGG - Intergenic
1134984817 16:18642136-18642158 GCTACTGGGGAGGGTGAGGTGGG - Intergenic
1135255772 16:20940537-20940559 GCTACTTGGGAGGGTGAAGTGGG - Intronic
1135257667 16:20954109-20954131 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1135497650 16:22966475-22966497 GCTGCTGGGGAGTGTCGAGGAGG - Intergenic
1135541265 16:23332138-23332160 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1135548693 16:23382156-23382178 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1135751060 16:25059123-25059145 GCGGCTGCGGAGGGTGTAGTGGG - Intergenic
1136233079 16:28898869-28898891 GCTACTGGGGAGCCTGAGGTGGG + Intronic
1136349324 16:29696872-29696894 GCAGCTGGGGCGCGGGGAGCCGG - Intronic
1136610042 16:31360629-31360651 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1137269776 16:46895634-46895656 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1137674218 16:50296162-50296184 GCTGCTCGGGAGGCTGAAGTGGG - Intronic
1138045574 16:53720899-53720921 GCTACTGAGGAGCCTGGGGTGGG - Intronic
1138143717 16:54589669-54589691 GCTGCTGGGGAGGGTGGGGCAGG + Intergenic
1138371464 16:56530376-56530398 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
1138525577 16:57604389-57604411 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1138685748 16:58724063-58724085 GCTACTTGGGAGGCTGGAGTGGG - Intronic
1139057072 16:63198950-63198972 GCTACTTGGGAGGATGGAGTGGG - Intergenic
1139458493 16:67103461-67103483 GCTACTTGGGAGGCTGGAGTGGG + Intergenic
1139461158 16:67123463-67123485 GCTACTGGGGAGGCTGGAGCAGG + Intronic
1139472767 16:67187110-67187132 AATGATGGGGAGCCTGGAGTTGG - Exonic
1139660186 16:68415294-68415316 GTGGCTAGAGAGCGTGGAGTGGG + Intronic
1139795705 16:69481548-69481570 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
1140113121 16:72020465-72020487 GCTGCTCGGGAGGCTGAAGTAGG - Intronic
1140284516 16:73589322-73589344 GCTGCTTGGGAGGCTGAAGTAGG + Intergenic
1140465326 16:75176643-75176665 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
1140872185 16:79117121-79117143 GCTACTGGGAAGGCTGGAGTAGG - Intronic
1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG + Exonic
1141178509 16:81736683-81736705 GCTACTCGGGAGGGTGAAGTAGG - Intergenic
1141358192 16:83369528-83369550 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1141597630 16:85107032-85107054 GCTGTTGGGGAGGGTGAGGTAGG + Intronic
1141843455 16:86590232-86590254 GCTGCTGTGGACCATGGAGGTGG + Intergenic
1141941280 16:87277833-87277855 GCTGCGGGGCAGCCTGGAGGAGG - Intronic
1141980703 16:87548211-87548233 AGTGCTGGGGAGGGTGGGGTTGG + Intergenic
1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG + Intergenic
1142385063 16:89758827-89758849 GCGGCTCGGGACCTTGGAGTAGG + Intronic
1142475972 17:190209-190231 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1142482612 17:228104-228126 GCTGGAGGGGAGCCTGGGGTGGG + Intronic
1142637235 17:1265548-1265570 GCTGCTGGGGAGGCTGAGGTAGG - Intergenic
1142711248 17:1725046-1725068 GCTGCTCCGGAGCGTGGAGAGGG + Exonic
1142828561 17:2530423-2530445 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1142849870 17:2699436-2699458 GCTACTCGGGAGGCTGGAGTGGG - Intronic
1143124829 17:4635320-4635342 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1143187537 17:5019733-5019755 GCTGCTGGGGAGGATAGAGGTGG + Intronic
1143268519 17:5658586-5658608 GGGGCTGGGGAGGGTGGAGCTGG + Intergenic
1143328958 17:6120219-6120241 GCTGCTCGGGAGAGGGAAGTGGG - Intronic
1143618943 17:8070193-8070215 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1143758806 17:9086254-9086276 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
1143887773 17:10078201-10078223 GCTACTGGGGAGCCTGAGGTGGG - Intronic
1144115774 17:12089021-12089043 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1144140161 17:12340493-12340515 GCTACTGGGGAGGGTGAAGTGGG - Intergenic
1144483909 17:15649396-15649418 GCTGCTAGGGAGGCTGCAGTAGG - Intronic
1144560943 17:16320037-16320059 GCTGCTTGGGAGGTTGGGGTGGG + Intronic
1144701949 17:17346138-17346160 GAGGCTGGGGAGGGTGGGGTGGG - Intronic
1144720546 17:17466608-17466630 GCTGCTGGAGATCTTGTAGTGGG - Intergenic
1144798524 17:17909583-17909605 GCTGCTGGGGGGTGTGGGGGTGG + Intronic
1145280473 17:21463860-21463882 GCTGCGGGGGAGCGGGGACTTGG - Intergenic
1145820160 17:27826549-27826571 GCTGCTCGGGAGCCTGAGGTGGG - Intronic
1145988903 17:29066289-29066311 TCTGCTGGGGAGCAAGGAGTAGG + Intergenic
1146213428 17:30959592-30959614 GCTACTGGGGAGGGTGAGGTGGG + Intergenic
1146445372 17:32928313-32928335 GCTGCCGGGGAGAGGGGAGGCGG + Intronic
1146911913 17:36653761-36653783 GCGGCAGGGGAGGGGGGAGTGGG + Intergenic
1146996014 17:37321634-37321656 GCTGCTGGGGAGGGTGAGGCAGG + Intronic
1147258834 17:39197208-39197230 GATGCTGCGGAGCGGGGAGGGGG - Intronic
1147294599 17:39472093-39472115 GCTGCTGGGGAGGGTGAGGTGGG - Intronic
1147396860 17:40150258-40150280 GCTACTTGGGAGCTTGGAGTGGG + Intronic
1147478857 17:40739970-40739992 GCTACTCGGGAGGGTGGGGTGGG - Intergenic
1147583425 17:41639173-41639195 GCTGCAGGGCAGAGTGGAGAGGG - Intergenic
1147617505 17:41838371-41838393 GCTACTTGGGAGGCTGGAGTAGG - Intronic
1147621018 17:41866740-41866762 GCTACTTGGGAGGCTGGAGTGGG + Intergenic
1147929627 17:43970087-43970109 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1147934972 17:44006057-44006079 GCTGCAGTGGTGCCTGGAGTCGG + Exonic
1148114308 17:45166234-45166256 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1148177795 17:45582855-45582877 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1148433892 17:47666162-47666184 GCTACTGGGGAGGCTAGAGTGGG - Intronic
1148741099 17:49893156-49893178 GCTGCTTGGGAGGGTGAGGTGGG + Intergenic
1148857192 17:50585255-50585277 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1148985876 17:51620622-51620644 GCTACTTGGGAGGGTGGGGTGGG + Intergenic
1149610535 17:57955342-57955364 GCGGCTGGGGCGCGGGGAGGCGG + Intergenic
1149695994 17:58616540-58616562 GCTACTTGGGAGGGTGGAGTGGG - Intronic
1149813680 17:59703124-59703146 GCTACTGGGGAGGTTGAAGTGGG - Intronic
1149815962 17:59724098-59724120 GCTGCTCGGGAGGCTGAAGTGGG + Intronic
1150140952 17:62728134-62728156 GCTACTTGGGAGGCTGGAGTGGG - Intronic
1150514805 17:65796940-65796962 GCTGCTTGGGAGCCTGAGGTAGG + Intronic
1150597408 17:66618241-66618263 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1150803409 17:68300049-68300071 GCTGCTAGGGAGGCTGAAGTGGG - Intronic
1151181787 17:72334486-72334508 GCTGCTGGGAAGAATGCAGTAGG + Intergenic
1151741870 17:75988448-75988470 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1152225966 17:79092979-79093001 CCTGCTGGGGTGCGAGGAGGTGG - Intronic
1152387010 17:79980723-79980745 GCTGTTGGGGTGCGCGGAGGCGG - Intronic
1152420855 17:80192396-80192418 ACTGCTGGGGAGGGTGAAATGGG + Intronic
1152437775 17:80286680-80286702 GGAGGTGGGGGGCGTGGAGTGGG + Intronic
1152561172 17:81079524-81079546 GATGCTGGGGAGTGAGGAGGAGG - Intronic
1152624239 17:81380955-81380977 TGTGCAGGGGAGCGTGGACTTGG - Intergenic
1152626771 17:81391277-81391299 GCTCTTGGGGAGCGTGGGGGTGG + Intergenic
1152693079 17:81729945-81729967 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1152859979 17:82690883-82690905 GCCCCGGGGGAGCATGGAGTGGG + Intronic
1152911948 17:83010083-83010105 GCTGCAGGGGACCCTGGTGTGGG + Intronic
1152944079 17:83189525-83189547 GCTCCTGGCCAGCCTGGAGTGGG + Intergenic
1153255234 18:3163562-3163584 GCTACTTGGGAGGCTGGAGTGGG - Intronic
1153842755 18:9021949-9021971 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1154345691 18:13541962-13541984 GCTACTGGGGAGGCTGGGGTGGG + Intronic
1154975294 18:21451603-21451625 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1155466535 18:26142149-26142171 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1155946559 18:31858979-31859001 GCTACTGGGGAGGCTGCAGTGGG + Intronic
1155993897 18:32309502-32309524 GCTGCTGGGGAGACTGAAGCAGG + Intronic
1156336022 18:36172153-36172175 GCTACTTGGGAGGGTGAAGTGGG + Intronic
1156881284 18:42083783-42083805 GCTGCTGGTGAGAGCAGAGTTGG + Exonic
1157762398 18:50274350-50274372 GCTGCTGGGGTGGGGGGAATGGG + Exonic
1158506560 18:58051144-58051166 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1160251882 18:77210251-77210273 GCTGCCGGGTGGGGTGGAGTGGG + Intergenic
1160780922 19:877716-877738 GCTGCTGGGGCACGTGGGGCAGG - Intronic
1160780948 19:877790-877812 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160780980 19:877902-877924 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781002 19:877970-877992 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781020 19:878032-878054 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781060 19:878182-878204 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781085 19:878250-878272 GCTGCTGGGGCCCGTGGGGCTGG - Intronic
1160781102 19:878306-878328 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781124 19:878374-878396 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781151 19:878448-878470 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1160781168 19:878504-878526 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781204 19:878628-878650 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781220 19:878684-878706 GCTGCTGGGGCACGTGGGGTTGG - Intronic
1160781238 19:878740-878762 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781257 19:878796-878818 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781282 19:878864-878886 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781353 19:879074-879096 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781378 19:879142-879164 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781419 19:879318-879340 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781450 19:879430-879452 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781467 19:879486-879508 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781503 19:879622-879644 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781519 19:879678-879700 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781543 19:879766-879788 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781561 19:879822-879844 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781586 19:879910-879932 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1160812352 19:1018272-1018294 GGTGCTGGGGAGAGAGGAGGCGG - Intronic
1160909924 19:1469666-1469688 GCTGCTGCGGCGCGCGGCGTCGG - Exonic
1160946103 19:1644801-1644823 CCTGGTGGGGAGGGTGGGGTGGG - Intronic
1161081784 19:2314355-2314377 TCTGTTGGGGAGGGTGGAGAGGG - Intronic
1161104760 19:2437813-2437835 GCTGCTGGGGATCGGGATGTGGG - Intronic
1161602128 19:5190687-5190709 GAAGCTGGGGAGTGAGGAGTTGG + Intronic
1161783522 19:6309408-6309430 GCTACTTGGGAGGCTGGAGTGGG + Intronic
1161826735 19:6572505-6572527 GCTGCTGGGGGGGGTGGGGGAGG + Intergenic
1161838846 19:6666288-6666310 GCTGCTGGGGAAGCTGAAGTGGG + Intronic
1161885588 19:6992752-6992774 GCTGCTGGGGAGGCTGAGGTAGG - Intergenic
1162126859 19:8504072-8504094 GCTGCTTGGGAGGCTGGGGTGGG + Intergenic
1162294881 19:9806512-9806534 GCTGCTGGGGAGGATGAGGTGGG + Intergenic
1162354608 19:10174302-10174324 GCTGCTTGGGAGGGTGAGGTGGG + Intronic
1162430170 19:10623799-10623821 GCTACTGGGGAGGCTGAAGTAGG - Intronic
1162725172 19:12685967-12685989 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1162730440 19:12715362-12715384 GCTTCCAGGGAGCCTGGAGTGGG - Intronic
1162737462 19:12754530-12754552 CCTGCAGGGGAGCGGGGAATGGG - Exonic
1162939586 19:14000684-14000706 GCTGCTCGGGAGGCTGGGGTGGG + Intronic
1163038461 19:14585279-14585301 GCTACTCGGGAGGGTGTAGTAGG - Intronic
1163039156 19:14589540-14589562 GCTACTCGGGAGGGTGTAGTAGG - Intronic
1163046414 19:14645858-14645880 GCTGCTGGGGAAGCTGAAGTGGG + Intronic
1163306262 19:16481191-16481213 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1163401281 19:17094493-17094515 GCTGCTTGGGGATGTGGAGTGGG - Intronic
1163434693 19:17288459-17288481 GCTGCTTGGGAGCCTGAGGTGGG + Intergenic
1163525364 19:17817681-17817703 GCTACTGGGGAGGCTGGGGTGGG + Intronic
1163759961 19:19130809-19130831 GCTACTGGGGAGCCTGAGGTGGG + Intronic
1164261280 19:23570299-23570321 AATGCTGGGGAGGGTGGAGGTGG - Intronic
1164982061 19:32621514-32621536 GCTGCTAGGGAGGCTGAAGTAGG + Intronic
1165007509 19:32818711-32818733 TCCACTGGGGAGCATGGAGTAGG + Intronic
1165217293 19:34284943-34284965 GCTACTGGGGAGGCTGCAGTAGG + Intronic
1165259218 19:34598274-34598296 GCTGCAGCAGAGCGTGGAATGGG + Intronic
1165266068 19:34664564-34664586 GCTGCAGTAGAGCGTGGAGTGGG - Intronic
1165605104 19:37095708-37095730 GCTACTGGGGAGGCTGAAGTAGG - Intronic
1166734408 19:45075876-45075898 GCGGGTGGTGAGCGTGGGGTGGG + Intronic
1166834399 19:45658378-45658400 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1167115424 19:47486793-47486815 GCTGCAGGGGAGAGAGGAGCAGG + Intergenic
1167163697 19:47783855-47783877 GTTGCTGTTGAGCGTGGGGTGGG + Intronic
1167166748 19:47803932-47803954 GCAGCTGGGGAGGGTTGAGCAGG - Intronic
1167303035 19:48690499-48690521 GCTGCTTGGGAGGGTGAAGCAGG - Intergenic
1167425731 19:49428787-49428809 GTTGTTGGGGAGCGTGGCGGGGG - Exonic
1167522419 19:49963287-49963309 GCTGCTCGGGAGGCTGAAGTGGG - Intergenic
1167747246 19:51359161-51359183 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1168337673 19:55605620-55605642 GCTGCCGGGGAGGGGGGAGGGGG + Intronic
1168419048 19:56189039-56189061 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1168641322 19:58033819-58033841 GCTGCTGCGGAAAGTGGAGACGG - Intergenic
1168709400 19:58490055-58490077 GCTACTGGGGAGGCTGAAGTGGG - Intronic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
925680094 2:6411401-6411423 GCTACTGGGGAGGCTGCAGTAGG + Intergenic
925938098 2:8787478-8787500 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
926315020 2:11703275-11703297 CCTGCTGGGGGGATTGGAGTAGG + Intronic
926748116 2:16176746-16176768 GCTACTGGGGAGAGTGAAGCAGG - Intergenic
927342826 2:22001901-22001923 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
927596315 2:24401075-24401097 GCTACTTGGGAGGGTGAAGTGGG + Intergenic
927663792 2:25015299-25015321 GCTACTCGGGAGGGTGAAGTGGG + Intergenic
928047619 2:27953291-27953313 GCTACTTGGGAGCCTGGGGTAGG - Intronic
928094915 2:28398559-28398581 GCAGCTGGGGAGCCTGGACGAGG + Intronic
928554641 2:32411148-32411170 GCTACTGGGGAGGGTGAAGCAGG - Intronic
929494683 2:42430254-42430276 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
929503744 2:42511903-42511925 GCTGCTGGGGAGTCTGAAGCAGG + Intronic
929679027 2:43969792-43969814 GCTGCTTGGGAGGCTGGGGTGGG - Intronic
929702999 2:44181054-44181076 GCTGCTTGGGAGGCTGGGGTAGG - Intronic
929721412 2:44372371-44372393 GCTGCTAGGGAGCCTGAGGTAGG + Intronic
929768918 2:44875000-44875022 GCTACTGGGGAGGGTGAGGTGGG + Intergenic
930021345 2:47003868-47003890 GCTGCTGGAGGTGGTGGAGTGGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930901199 2:56509440-56509462 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
931014611 2:57961963-57961985 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
931139935 2:59446242-59446264 GCTGGTGGGGAGCCTGGAAGGGG + Intergenic
931373297 2:61684425-61684447 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
931489161 2:62725607-62725629 GGTGCTGGTGGGGGTGGAGTTGG + Intronic
931630271 2:64292253-64292275 GCTGCTGGGGAGGTTGAGGTGGG + Intergenic
932273055 2:70427869-70427891 GCTCCTGGGGAGGCTGAAGTGGG + Intergenic
932327054 2:70870324-70870346 GCTGCTTGGGAGGTTGAAGTGGG - Intergenic
932330644 2:70896677-70896699 GCTGCTGCGGGTCGTGGTGTTGG + Intergenic
932389825 2:71377151-71377173 GCTGCTGGGTAGGGTGCGGTGGG + Intronic
932886930 2:75556991-75557013 GCTGCTTTTGAGGGTGGAGTAGG - Intronic
933617330 2:84496026-84496048 GCTGCTGAGAAGCGTGGAGGTGG - Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934946665 2:98547394-98547416 GATGCTGGGGTGCATGGAGCAGG + Intronic
935283059 2:101535946-101535968 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
935307820 2:101754769-101754791 GCTGCTGAGGACTGAGGAGTTGG - Intronic
935355956 2:102200043-102200065 GCTACTCGGGAGGCTGGAGTGGG + Intronic
935410441 2:102756595-102756617 GCTACTTGGGAGGGTGGGGTGGG + Intronic
935619751 2:105118423-105118445 GAGGCTGGGGAGAGGGGAGTAGG + Intergenic
936008445 2:108909847-108909869 GCTCCTTGGGAGCCTGGACTCGG + Intronic
936355326 2:111745348-111745370 GCTGCTAGGGAGGGTGAAGCAGG - Intergenic
936406237 2:112206842-112206864 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
937963496 2:127482583-127482605 GCTGCTGGGAATTGTGTAGTTGG - Intronic
938269668 2:129958502-129958524 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
938599056 2:132818574-132818596 GCTACTGGGGAGTGTGAGGTGGG + Intronic
938896842 2:135760317-135760339 GCTACTAGGGAGGGTGAAGTAGG + Intronic
940356873 2:152753024-152753046 GCTACTTGGGAGGCTGGAGTGGG + Intronic
940671029 2:156668149-156668171 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
941009645 2:160285143-160285165 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
942244944 2:173999263-173999285 GCTGCTGGGGAGCTTGTGGTCGG - Intergenic
942274930 2:174314150-174314172 GCTACTTGGGAGCCTGGGGTGGG - Intergenic
942450734 2:176106820-176106842 GCTTCTAGGGAGCCTGGAGCCGG + Intronic
942455730 2:176137010-176137032 CATGCTGGGGAGCGGGGAGGGGG - Intergenic
942958697 2:181804222-181804244 GCTGCTGGGGAGCTCGAACTGGG - Intergenic
943379061 2:187120239-187120261 GCTACTCGGGAGGCTGGAGTGGG + Intergenic
944057727 2:195540743-195540765 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
944221388 2:197308058-197308080 GCTACTGGGGAGGCTGAAGTGGG + Intronic
944522634 2:200587177-200587199 GCTACTGGGGAGGGTGAAGGAGG + Intronic
944574599 2:201079552-201079574 GCTACTAGGGAGGCTGGAGTGGG - Intronic
944703325 2:202264818-202264840 GCTGCTCCGGAGGGTGAAGTGGG + Intergenic
944826378 2:203487490-203487512 GCTGCTCGGGAGGGTGAGGTAGG - Intronic
945061540 2:205913280-205913302 GCTGCTTGGGAGGGTGAAGTGGG + Intergenic
945260606 2:207839813-207839835 GCTACTGGGGAGGCTGAAGTAGG + Intronic
945988250 2:216371701-216371723 GCGGCTGGGGAGTGAGGAGGGGG + Exonic
946145299 2:217726009-217726031 GGTGTGGGGGAGGGTGGAGTGGG - Intronic
946186292 2:217982513-217982535 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
946304406 2:218847548-218847570 GCTTCTGGGGATAGGGGAGTGGG - Intergenic
947095591 2:226563046-226563068 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
947413456 2:229868311-229868333 GCTACTTGGGAGGGTGAAGTGGG - Intronic
947426357 2:229986389-229986411 TCTGCTGGGGAGGCTGAAGTGGG + Intronic
947509264 2:230735623-230735645 GCTACTTGGGAGCCTGGGGTAGG - Intronic
947776604 2:232716915-232716937 GCTACTGGGGAGGCTGAAGTTGG - Intronic
948225853 2:236308935-236308957 GCTGCAGGGGAGCTGTGAGTGGG + Intergenic
948554281 2:238796517-238796539 GCTGATGTGGAGCAGGGAGTGGG - Intergenic
948765703 2:240217639-240217661 GCTGAAGGGGTGGGTGGAGTTGG - Intergenic
948817823 2:240522023-240522045 GCTGGTGGGGAGCCTGGCGGTGG + Intronic
948836190 2:240627078-240627100 GCTGCCGGGGACCGTGGGGATGG - Intronic
948999223 2:241602843-241602865 GCTGGTGGGGACCGTGGGGATGG - Intronic
1168762527 20:359095-359117 GCTACTGGGGAGCATGAGGTGGG - Intronic
1168847904 20:958091-958113 GCTGCTGGTGAGAGTGGCCTTGG - Intergenic
1169176010 20:3514843-3514865 GCTGTTGGGGAGGCTGAAGTGGG + Intronic
1169218927 20:3809742-3809764 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1170619123 20:17979519-17979541 GCTGCTGGGGAGGCTGAGGTAGG - Intronic
1170695417 20:18653280-18653302 GCTGCTTGGGAGGCTGCAGTGGG + Intronic
1171034280 20:21703714-21703736 GCTCCGGGGGTGCGGGGAGTGGG - Intergenic
1171416625 20:24985885-24985907 ACTGCTGGGGAGGGTGCAGAAGG + Intronic
1171799854 20:29601996-29602018 GCTGCTGGGGAGGATGAGGTAGG - Intergenic
1171869565 20:30514238-30514260 GCTGCAGGGGAGGGGGGAGGAGG + Intergenic
1172209540 20:33187152-33187174 GCAGCTGGGGAGCCTGGGGTAGG + Intergenic
1172576967 20:36016945-36016967 GCTACTTGGGAGGGTGGGGTGGG + Intronic
1173155162 20:40602394-40602416 GCTACTTGGGAGGGTGAAGTGGG - Intergenic
1173163671 20:40671174-40671196 GCTGGTGGGGAGGATGGAGCAGG - Intergenic
1173447889 20:43136910-43136932 GCTGCTGGGGACCCTGGGGAAGG - Intronic
1173471094 20:43324145-43324167 GCTGCTTGGGAGGCTGGGGTGGG - Intergenic
1173486899 20:43447779-43447801 GCTGCTTGGGAGGCTGGAGCAGG - Intergenic
1174027535 20:47590697-47590719 GCTGCTGGGGAGGCTGAGGTAGG + Intronic
1174137507 20:48390805-48390827 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
1174235880 20:49091311-49091333 GCTGCTTGGGAGGCTGAAGTAGG + Intronic
1174305363 20:49610990-49611012 GCCTCTGGGGAGGGTGGAGCTGG + Intergenic
1174311971 20:49663590-49663612 GCTGCTTGGGAGGCTGAAGTAGG + Intronic
1174431118 20:50469851-50469873 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
1174612987 20:51814365-51814387 GCTACTGGGGAGGGTGAGGTAGG + Intergenic
1175090671 20:56500891-56500913 GCTGCTGGGGAGGCTGAAGTGGG - Intronic
1175244284 20:57572286-57572308 GCTGCTAGGGAGAGGGGAGAAGG - Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175332013 20:58171586-58171608 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
1175442966 20:59003761-59003783 GCTCCTGCGGAGAGTGGAGCAGG - Intronic
1175717737 20:61266623-61266645 GCTGGTGGGGAGTCTGGAGAGGG + Intronic
1175844115 20:62049677-62049699 ACTGCTGGGGAGTTGGGAGTTGG - Intronic
1175937477 20:62520441-62520463 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1175948474 20:62569797-62569819 GCTGCTGAGGAGAGGGAAGTAGG - Intronic
1175950927 20:62582589-62582611 GCAGCTGGGGAGCCTGGAGAAGG + Intergenic
1176001426 20:62833183-62833205 TCTGCTGGGCAGCGTGGGGATGG + Intronic
1176012692 20:62908089-62908111 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1176013787 20:62917137-62917159 GCTACTGGGGAGGGTGAGGTGGG - Intronic
1176894112 21:14355354-14355376 GCTACTTGGGAGGGTGAAGTAGG + Intergenic
1178569799 21:33725486-33725508 GCTGCTAGGGAGGCTGAAGTGGG + Intronic
1178606412 21:34040143-34040165 GGTGCTGGGGAGGGTGGGGATGG - Intergenic
1179104123 21:38383436-38383458 GCTGGTGGGGAGCCTAGTGTTGG + Exonic
1179534747 21:42044273-42044295 GGTGGTGAGGAGCGTGGAATGGG - Intergenic
1180079761 21:45481259-45481281 GCTGGTGGGGAGCCTGCCGTGGG - Intronic
1180464084 22:15595164-15595186 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1180639153 22:17284108-17284130 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1180884066 22:19227392-19227414 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1181024865 22:20122439-20122461 GCTGCTGGGGACTGTCGAGGTGG - Intronic
1181276487 22:21690270-21690292 GCTGCTTGGGAGGGTGAGGTGGG + Intronic
1181418689 22:22780827-22780849 GCTACTGGGGAGGGTGAAGCAGG + Intronic
1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG + Intergenic
1181816513 22:25441353-25441375 GCTACTCGGGAGGGTGAAGTGGG - Intergenic
1181816646 22:25442577-25442599 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1182029413 22:27145920-27145942 GCTGCTCGGGAGCCTGAAGCAGG + Intergenic
1182099867 22:27650294-27650316 GATGCTGGGAAGGGTGGATTTGG + Intergenic
1182299292 22:29328895-29328917 GCTGCAGGGGAGAGAGGGGTCGG + Exonic
1182346208 22:29667347-29667369 GCTACTGGGGAGGGTGAGGTGGG - Intronic
1182433125 22:30312409-30312431 GCTGCTCGGGAGACTGAAGTGGG + Intronic
1182638879 22:31751158-31751180 GCTACTGGGGAGCCTGAAGCAGG + Intergenic
1182728600 22:32469161-32469183 GCTGCTGGGGAGGCTGAGGTAGG + Intergenic
1182791845 22:32959704-32959726 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1182793488 22:32972895-32972917 GCTACTTGGGAGGCTGGAGTGGG + Intronic
1183078801 22:35443296-35443318 GCTACTGGGGAGGGTGAGGTAGG - Intergenic
1183302418 22:37064893-37064915 GCCGGAGGGGAGCGTGGACTGGG - Intergenic
1183402692 22:37613920-37613942 GCTGCAGGGGTGGGAGGAGTGGG + Intronic
1183604776 22:38862018-38862040 GCTGCTGGGTGGAGTGGAGAGGG - Exonic
1183743407 22:39680344-39680366 ACTGCTGGGGAGAGGGGAGGGGG - Intronic
1183757652 22:39784768-39784790 GGGGCTGGGAAGGGTGGAGTGGG + Intronic
1183829410 22:40409885-40409907 TGTGCTGGGGAACGTGGAGTGGG - Exonic
1183944716 22:41318635-41318657 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1184525779 22:45021435-45021457 GCTGCTGAGAGGCGTGGGGTAGG + Intergenic
1184557192 22:45239991-45240013 TCTGCTGGGGGGCGTGGGATGGG - Intronic
1184566050 22:45292794-45292816 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1184594540 22:45505881-45505903 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1184709983 22:46244170-46244192 GGAGATGGGGAGCCTGGAGTAGG + Exonic
1184726595 22:46350901-46350923 GCTGCTGGGCCGCGAGGAATTGG + Intronic
1184941212 22:47766853-47766875 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1185036007 22:48477258-48477280 GGTGATGGGGTGTGTGGAGTGGG - Intergenic
1185066847 22:48636722-48636744 GCTGCTGTGAAGCCTGGAGATGG + Intronic
1185316276 22:50180559-50180581 CCTGCAGGGGAGCGAGGAGGGGG + Intergenic
1185336460 22:50272790-50272812 GCTGCTGGGGTGCATGCGGTGGG - Intergenic
1185372020 22:50465373-50465395 GCTCCTGGGCAGCCTGGGGTGGG - Intronic
1185378583 22:50495447-50495469 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
950074105 3:10174977-10174999 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
950345069 3:12286493-12286515 GCTACTTGGGAGCCTGGGGTGGG + Intergenic
950354676 3:12396644-12396666 GCTACTCGGGAGTCTGGAGTGGG + Intronic
950395761 3:12732735-12732757 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
950652668 3:14416954-14416976 GCTGCTAGGGAGGCTGGGGTGGG - Intronic
950776977 3:15358515-15358537 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
950830098 3:15864981-15865003 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
951171759 3:19550500-19550522 GCTACTGGGGAGGCTGGGGTAGG - Intergenic
951614973 3:24532168-24532190 GCTGCTCGGGAGGCTGGTGTGGG + Intergenic
952910318 3:38179140-38179162 GCTACTAGGGAGCGTGAGGTAGG - Intronic
953310657 3:41875066-41875088 GCTACTGGGGAGGCTGAAGTGGG + Intronic
953314980 3:41918711-41918733 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
953342460 3:42147076-42147098 GCTGTTTGGGAGCTTGCAGTGGG + Intronic
953450717 3:43003381-43003403 GCTACTCGGGAGGGTGAAGTGGG + Intronic
953724144 3:45382784-45382806 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
953879012 3:46681988-46682010 ACTGCTGGGAGGCGTGCAGTGGG - Intronic
953982228 3:47418627-47418649 GCTGCTGGGTGGGGTGGGGTGGG - Intronic
954143220 3:48621098-48621120 GGAGCTGGGGAGCAGGGAGTAGG + Intronic
954252439 3:49378356-49378378 GCTGCTGGGGAATTTGAAGTGGG - Intronic
954340005 3:49945768-49945790 GCTGCTGGGGAGGCTGGGGCAGG + Intronic
954733977 3:52689704-52689726 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
954835898 3:53467585-53467607 GCTACTTGGGAGAGTGAAGTAGG + Intergenic
954860923 3:53689768-53689790 GCTACTTGGGAGGGTGAAGTGGG - Intronic
955251641 3:57288824-57288846 GCTACTCGGGAGGGTGGGGTAGG - Intronic
955293728 3:57716402-57716424 GCTGCTCGGGAGGCTGAAGTGGG - Intergenic
955742469 3:62106612-62106634 GCTACTGGGGAGGCTGGTGTGGG - Intronic
956190321 3:66601871-66601893 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
956741689 3:72280551-72280573 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
957299026 3:78367179-78367201 GCTGCTCAGGAGCTTGCAGTGGG - Intergenic
957368549 3:79259254-79259276 GCTGCTGGGGAGGCTGAAGTGGG - Intronic
957371487 3:79300367-79300389 GCAGCTGCGGAGCGTGTACTGGG + Intronic
960647412 3:119902824-119902846 GCTACTTGGGAGCCTGAAGTGGG - Intronic
960933917 3:122883855-122883877 TCTGCTGGGGATCCTGGAGAGGG - Intergenic
961007126 3:123412597-123412619 TGTGCTGGGGAGCTGGGAGTCGG + Intronic
961071053 3:123927303-123927325 GCTACTTGGGAGCCTGAAGTGGG + Intronic
961173348 3:124814946-124814968 GCTGATGGGGAGTGGGGAGCAGG - Intronic
961291250 3:125848586-125848608 GCTACTGGGGAGCCTGAGGTAGG - Intergenic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
961664703 3:128488232-128488254 GCTCCTGGGGAGGGGGCAGTTGG - Intronic
961982102 3:131090874-131090896 GCTGCTTGCGAGCGTGGAGTGGG - Intronic
962237325 3:133717712-133717734 GCGGCTGGGGTGGGGGGAGTTGG + Intergenic
962293642 3:134159993-134160015 GCTCCTGGAGAGCGTGCAGGGGG + Intronic
962455649 3:135563302-135563324 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
962456849 3:135572778-135572800 GCTGCTGGAGAGCGAGGACAGGG - Intergenic
962520830 3:136196151-136196173 GCTGGAGTGGCGCGTGGAGTCGG - Intronic
962754710 3:138458717-138458739 GCTGCTGGGGCTGGTGGAGGTGG - Intronic
963149649 3:142032213-142032235 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
965765784 3:172128563-172128585 GGGGCTGGGGAGTGGGGAGTTGG + Intronic
966284420 3:178277120-178277142 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
966911782 3:184563922-184563944 GCTGGTGCTGAGTGTGGAGTGGG + Intronic
967168448 3:186805330-186805352 GCTACTGGGGAGGCTGAAGTGGG - Intronic
967645957 3:191924058-191924080 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
967681617 3:192370429-192370451 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
968257233 3:197286982-197287004 GCTGCTTGGGAGCCTGAGGTAGG - Intronic
968577321 4:1373964-1373986 GCTCCTGGGGAGCGTGGCATGGG + Intronic
968820978 4:2850923-2850945 CCAGCTGGGGAGAATGGAGTGGG + Intronic
969006041 4:4020902-4020924 GCTACTGGGGAGCCTGAGGTAGG + Intergenic
969585295 4:8088035-8088057 GGTGCTGGGGGGCGCTGAGTGGG - Intronic
969716082 4:8868838-8868860 CCTTCTGGGGAGCTTGGCGTGGG - Intronic
969806907 4:9616388-9616410 GCTACTGGGGAGCCTGAGGTAGG - Intergenic
970148480 4:13063948-13063970 TCTGCTAGGGACCGTAGAGTTGG + Intergenic
971198803 4:24493408-24493430 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
971622418 4:28872595-28872617 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
971748797 4:30619462-30619484 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
972502679 4:39693279-39693301 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
972531316 4:39963718-39963740 GCTACTGGGGAGCCTGAGGTAGG + Intronic
972588291 4:40459452-40459474 GCTACTGGGGAGGGTGAGGTGGG + Intronic
972763071 4:42125848-42125870 GCTACTGGGGAGGCTGAAGTGGG - Intronic
973778069 4:54262041-54262063 GCTACTGGGGAGGCTGAAGTGGG - Intronic
974356995 4:60825345-60825367 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
974394577 4:61318063-61318085 GCTGCTTGGGAGCCTGAGGTGGG + Intronic
975760121 4:77611973-77611995 ACTACTGGGGAGCCTGAAGTGGG - Intergenic
975781696 4:77847283-77847305 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
976068324 4:81215010-81215032 GCGGCTGGGGAGGGCGGCGTGGG - Exonic
976203815 4:82605876-82605898 GCTGCTGGGGAGGTTGAAGTGGG - Intergenic
976662613 4:87555468-87555490 GCTACTCGGGAGGCTGGAGTGGG - Intergenic
976711154 4:88072922-88072944 GCTACTCGGGAGCCTGAAGTGGG + Intronic
977628380 4:99214278-99214300 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
978350440 4:107815777-107815799 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
978467804 4:109028218-109028240 GCTACTGGGGAGACTGAAGTGGG - Intronic
979072392 4:116224562-116224584 GGTACTGGGGAGCCTGAAGTGGG - Intergenic
979668259 4:123336448-123336470 GCTGCTGGGAAGTTTGGACTGGG - Intergenic
979965958 4:127077102-127077124 GCTGCTGGGAAGTTTGGACTGGG - Intergenic
980307336 4:131079327-131079349 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
981141885 4:141278452-141278474 TGTGGTGGGGAGCGGGGAGTGGG + Intergenic
981313402 4:143318135-143318157 GCTGCTGGGGAGGCTGAAGAAGG + Intergenic
981320509 4:143386497-143386519 GCTACTGGGGAGGCTGAAGTGGG - Intronic
981601383 4:146492477-146492499 GCTCCTTGGGAGCTTGAAGTGGG - Intronic
982002485 4:151033726-151033748 GCTGCTTGGGAGGGTGAGGTGGG + Intergenic
982665373 4:158254509-158254531 GCTGCTGGGGCGGCTGAAGTAGG + Exonic
982691540 4:158553075-158553097 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
982771263 4:159399497-159399519 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
982862444 4:160470173-160470195 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
983608227 4:169614381-169614403 GCTGCTCGGGAGGCTGAAGTGGG - Intronic
984284893 4:177716663-177716685 GCTGCTCGGGAGGCTGAAGTGGG - Intergenic
984612610 4:181857644-181857666 GCTACTGGGGAGGGTGAGGTGGG + Intergenic
984696518 4:182785186-182785208 GCTACTTGGGAGCCTGGGGTGGG - Intronic
984890596 4:184489436-184489458 GCTGCTCGGGAGGCTGAAGTGGG - Intergenic
984940234 4:184924867-184924889 GATGCTGGGGTGGCTGGAGTGGG - Intergenic
984955085 4:185037087-185037109 CCTGCTGGTGAGCGTGGTGAGGG - Intergenic
985688480 5:1294474-1294496 ACTGCGGGGGAGCGGGGCGTGGG - Exonic
985832239 5:2242345-2242367 GATGCTGTGGAGCTTGGGGTCGG + Intergenic
985942716 5:3151316-3151338 GCTGCTGGGGGGTTGGGAGTGGG - Intergenic
986061870 5:4199275-4199297 TCTGCTGGGCAGCGTGCACTTGG + Intergenic
986340058 5:6781242-6781264 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
986941306 5:12953704-12953726 GCTGCTGGGGGTGGTGGAGAGGG - Intergenic
987015104 5:13810185-13810207 GCTGCTGTGGAGCGCGGGGGCGG - Exonic
987286446 5:16462539-16462561 GCTGCTGGGGAGGCTGTGGTGGG + Intronic
987295427 5:16546277-16546299 GCTGCTTGGGAGGCTGGGGTGGG - Intronic
988271297 5:29021031-29021053 CCTGCTGGCGAGCCTGCAGTTGG + Intergenic
988512528 5:31877799-31877821 GCTGCTCGGGAGGGTGAGGTAGG - Intronic
988602080 5:32649420-32649442 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
988663720 5:33301797-33301819 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
989231828 5:39095742-39095764 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
989642387 5:43595481-43595503 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
990080295 5:51904226-51904248 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
990378341 5:55196004-55196026 GTTACTGGGGAGCCTGAAGTGGG - Intergenic
990490074 5:56295473-56295495 GCTGCTGCGGAGGGTGTACTGGG + Intergenic
990493686 5:56326013-56326035 GCTGCTGGTGAGGGTGGTGGTGG - Intergenic
991439140 5:66628142-66628164 GCTGCTCGGGAGGCTAGAGTGGG - Intronic
991513489 5:67407274-67407296 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
991695354 5:69265974-69265996 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
991904660 5:71497898-71497920 GCTACTGGGGAGGGTGATGTGGG - Intronic
992055446 5:72984742-72984764 GCTACTTGGGAGGCTGGAGTGGG - Intronic
992437874 5:76772810-76772832 GCTGCTAGGGAGGCTGAAGTGGG + Intergenic
992565656 5:77993122-77993144 GCAGGTGGGGAGTGTGGAGTTGG + Intergenic
992703985 5:79369401-79369423 GCAGGTGGGGAGGGTGGAGAGGG + Intergenic
993236211 5:85313602-85313624 GCTGCTCGGGAGGCTGGGGTGGG - Intergenic
993294288 5:86114747-86114769 GCTACTGGGGAGCATGAGGTAGG + Intergenic
993469913 5:88294582-88294604 GCTGCTTGTGAGCCTGGGGTGGG + Intergenic
993534294 5:89062545-89062567 GCTACTGGGGAGGGTGAGGTGGG - Intergenic
993726054 5:91367528-91367550 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
993872375 5:93267861-93267883 GCTGCTGGTGGGCGTGGTGACGG + Intergenic
993990692 5:94654056-94654078 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
994039690 5:95244676-95244698 GCTGCTGGGAAGCATGAACTGGG + Intronic
994625704 5:102215748-102215770 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
995876138 5:116792264-116792286 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
997194004 5:131965608-131965630 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
997882730 5:137604777-137604799 GCTGCTGGAGAGTGCGGAGCTGG - Intergenic
998126343 5:139625167-139625189 GCTACTGGGGAGGCTGGGGTGGG - Intronic
998244719 5:140489076-140489098 GCTGCTAGGGAGACTGTAGTGGG + Intronic
998247873 5:140525372-140525394 GCTACTGGGGAGGCTGGGGTGGG - Intronic
998537495 5:142947906-142947928 GCTGCTCGGGAGTGTGAAGCGGG + Intronic
998693288 5:144611893-144611915 GCAGCTTGGGAACGTAGAGTGGG + Intergenic
998819899 5:146049009-146049031 CCTGATGGGGGGCATGGAGTGGG - Intronic
998839217 5:146235442-146235464 ACTGCTTGGGAGCTTGGTGTGGG + Intronic
998875657 5:146596564-146596586 GCTGCTGGGGAGCCTTAACTAGG - Intronic
999552835 5:152708170-152708192 GCTGGTGGGGAGGGTCAAGTGGG - Intergenic
999697442 5:154199350-154199372 ACTCCTGGGGAGAATGGAGTGGG - Intronic
999767217 5:154750379-154750401 GCTGCTGGGGAGGTTGAGGTGGG - Intronic
1000007857 5:157204120-157204142 GCTACTTGGGAGGGTGAAGTGGG - Intronic
1000031099 5:157402114-157402136 GCTCCTGGGGAGTGTGGGGTTGG - Intronic
1000139607 5:158389407-158389429 GCTGCAAGAGGGCGTGGAGTGGG - Intergenic
1000622222 5:163498781-163498803 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1001064446 5:168525106-168525128 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1001472176 5:172022197-172022219 GCTACTTGGGAGAGTGAAGTGGG + Intergenic
1001608335 5:172980221-172980243 GCTGCTGCGGAGGGTGAGGTGGG - Intergenic
1002001730 5:176199924-176199946 GCTGCGGGGGAGCCTGAAGCTGG - Intergenic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002273215 5:178086497-178086519 GCCGCTGCGGAGCGCGGAGCTGG - Intergenic
1002376926 5:178795624-178795646 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
1002415249 5:179117145-179117167 GCTGCTGGAGAGGATGGGGTGGG - Intronic
1002471445 5:179438392-179438414 GGGGCTGAGGAGCGTGGAGAAGG + Intergenic
1002478469 5:179483515-179483537 GCTACTTGGGAGGCTGGAGTAGG - Intergenic
1002508161 5:179695159-179695181 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1002515419 5:179754480-179754502 GCTACTGGGGAGACTGAAGTGGG + Intronic
1002717098 5:181234487-181234509 GCTGCTGGGGCAGGTGGAGCCGG - Exonic
1003238727 6:4322778-4322800 GCTGCTGGGGATAGGGGAGCTGG - Intergenic
1003450363 6:6225617-6225639 GCTACTCGGGAGCCTGAAGTGGG - Intronic
1003603132 6:7536642-7536664 GCTACTGGGGAGACTAGAGTGGG - Intergenic
1003897236 6:10619291-10619313 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1004094355 6:12538280-12538302 GCTACTCGGGAGCGTGAAGCAGG - Intergenic
1004165361 6:13251941-13251963 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1004196820 6:13512731-13512753 GCTGCTGGAGTGCCTGGACTAGG + Intergenic
1004204857 6:13583092-13583114 GCTACTGGGGAGGATGGGGTGGG + Intronic
1004255849 6:14063502-14063524 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
1004390992 6:15209658-15209680 GCTACTCGGGAGCCTGAAGTAGG - Intergenic
1004826127 6:19423183-19423205 GCTACTTGGGAGCGTGAGGTGGG - Intergenic
1005353565 6:24960636-24960658 GCTGCTGGGGAGGCTGAGGTGGG - Intronic
1005377961 6:25203386-25203408 GCTGCTGGGGAGCCTAAGGTGGG + Intergenic
1005646966 6:27848768-27848790 GCTACTTGGGAGGCTGGAGTAGG + Intronic
1005934478 6:30509768-30509790 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1006376493 6:33674282-33674304 GCTGCAGGGGTGTGTGGGGTTGG + Intronic
1006459105 6:34148044-34148066 GCTGGTGGGGGGCGGGGGGTGGG - Intronic
1006936048 6:37718945-37718967 GCTACTGGGGAGGGTGAGGTGGG + Intergenic
1007385857 6:41519806-41519828 GCTGCTGGGGTGGGGGCAGTGGG - Intergenic
1007553185 6:42745833-42745855 GCTTCTGGAGCGCGCGGAGTCGG - Exonic
1007641635 6:43345133-43345155 GCTACTGGGGAGCCTGAAGTGGG + Intronic
1007692974 6:43714790-43714812 CCTGCAGGGGAGCGGGGAGGGGG - Intergenic
1008059882 6:46985654-46985676 GCTGGCAGGGAGCGTGGAGGTGG + Intergenic
1008336312 6:50308584-50308606 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
1008533982 6:52492724-52492746 GCTACTGGGGAGGTTGAAGTGGG - Exonic
1008556771 6:52679864-52679886 GGTGGTGGGGAGGGTGGGGTGGG + Intronic
1008579292 6:52891133-52891155 GCTACTAGGGAGGGTGAAGTGGG + Intronic
1012280826 6:97326769-97326791 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1012342608 6:98146188-98146210 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
1012853179 6:104470868-104470890 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
1012867364 6:104634189-104634211 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1013034561 6:106367853-106367875 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1013087541 6:106869222-106869244 GCTACTGGGGAGGGTGAGGTGGG - Intergenic
1013257214 6:108399730-108399752 GCTACTGGGGAGGCTGGGGTGGG + Intronic
1013311066 6:108894252-108894274 GCTACTCGGGAGCCTGGGGTGGG + Intronic
1013500789 6:110749470-110749492 GCTACTTGGGAGGGTGAAGTGGG - Intronic
1013595387 6:111655962-111655984 GCTACTTGGGAGCCTGGGGTGGG + Intergenic
1013797091 6:113900232-113900254 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1015768714 6:136747031-136747053 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1015783294 6:136894081-136894103 GCTATTTGGGAGGGTGGAGTGGG + Intronic
1016471840 6:144383041-144383063 GCTACTTGGGAGGGTGGGGTGGG - Intronic
1016651139 6:146462325-146462347 GCAGCTGGGGACAGTGGAGATGG - Intergenic
1016886800 6:148966846-148966868 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1017001032 6:149997712-149997734 GCCACTGCCGAGCGTGGAGTGGG + Intergenic
1017145244 6:151228995-151229017 GCTGCTGGGGAGGCTGATGTGGG - Intergenic
1017264194 6:152423431-152423453 GTTGGTGGGGAGGGAGGAGTGGG - Intronic
1017546236 6:155453465-155453487 GCTGCAGAGGACCGTGGAGGAGG - Exonic
1018231968 6:161683628-161683650 GCTGCTTGGCAGGGTGGTGTGGG + Intronic
1018520270 6:164641558-164641580 GCTGCTTGGGAGGCTGAAGTAGG - Intergenic
1018577552 6:165275765-165275787 GATGGTGGAGAGCATGGAGTGGG - Intergenic
1018827326 6:167419136-167419158 GCTGCTGGGAGGCGTGCAGACGG + Intergenic
1019109683 6:169699868-169699890 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1019301093 7:303918-303940 GCTGCTGGGGACAGTTGAGGTGG + Intergenic
1019509955 7:1412839-1412861 GCAGCTGGTGTGCGTGCAGTCGG + Intergenic
1020186582 7:5963378-5963400 GCTGCAGAGGAGCGGGGAGAGGG - Intronic
1020266120 7:6561213-6561235 GCTGCTCGGGAGGCTGGGGTGGG - Intergenic
1020296334 7:6761396-6761418 GCTGCAGAGGAGCGGGGAGAGGG + Intronic
1020565340 7:9787837-9787859 GCTGATGGGGAATGTGGGGTTGG - Intergenic
1021031032 7:15736089-15736111 GATGCTGGGGAGTGTTGAGAGGG + Intergenic
1021729373 7:23581479-23581501 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1021860461 7:24900907-24900929 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1022467027 7:30658885-30658907 GCTGCTGGGGAGTGTAGGGATGG + Intronic
1022650968 7:32274317-32274339 GCTACTGGGGAGGCTGAAGTAGG - Intronic
1022727520 7:32994578-32994600 GCTGCTGGTGTGGGTGGAGTGGG - Intronic
1023229296 7:38008800-38008822 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1023986839 7:45101864-45101886 GCTGCTGGGGAGCGCCGACAAGG - Exonic
1024026084 7:45411034-45411056 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1024229530 7:47353753-47353775 GCAGCTGAGGAGGGTGGAGGAGG - Intronic
1024527286 7:50359722-50359744 GGGGCTGAGGAGCGTGGAATTGG - Intronic
1025046066 7:55693071-55693093 GCTGCTGGTGTGGGTGGAGTGGG + Intergenic
1025140251 7:56457163-56457185 GCTACTTGGGAGGGTGAAGTAGG - Intergenic
1025147459 7:56517050-56517072 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1026005614 7:66598160-66598182 GCTACTTGGGAGCCTGAAGTGGG - Intergenic
1026548482 7:71346079-71346101 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1026867357 7:73831930-73831952 GCTGCTGGGGACTGGGGACTGGG + Exonic
1026894011 7:73999752-73999774 GCTGCTGGGGAGGGTGGGCCTGG - Intergenic
1026941124 7:74288748-74288770 GCTACTGGGGAGGCTGGGGTGGG - Intergenic
1027159488 7:75791898-75791920 GCTGCTTGGGAGGGTGAGGTGGG - Intergenic
1027187250 7:75979860-75979882 GCAGCTGGGGAGGGTGGGTTTGG - Intronic
1027248504 7:76383656-76383678 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
1027391060 7:77703899-77703921 GCTACTGGGGAGGGTGAAGCAGG - Intronic
1027579705 7:79977814-79977836 GCGGCTGGGGAGGGTGTACTGGG - Intergenic
1027771781 7:82416101-82416123 GCTACTCGGGAGGGTGAAGTAGG + Intronic
1027777443 7:82484479-82484501 GCTACTGGGAAGCGTGAGGTGGG - Intergenic
1028215930 7:88133249-88133271 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1029142993 7:98424875-98424897 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1029164033 7:98573434-98573456 GCTGCTTGGGAGGCTGAAGTAGG + Intergenic
1029241835 7:99168620-99168642 GCTGCTTGGGAGCCTGAGGTGGG - Intergenic
1029485678 7:100838626-100838648 GGTACTGGGGAGGGTGAAGTGGG - Intronic
1029635132 7:101778517-101778539 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1030071401 7:105700791-105700813 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1030162257 7:106520899-106520921 GCTACTGGGGATGGAGGAGTGGG + Intergenic
1030173369 7:106627159-106627181 GCTACTTGGGAGAGTGAAGTGGG - Intergenic
1030532745 7:110730634-110730656 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1030603891 7:111618914-111618936 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
1030735838 7:113047655-113047677 GATGGTGGGGAGTGAGGAGTGGG - Intergenic
1031730274 7:125291858-125291880 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1032140253 7:129322701-129322723 GCTACTCGGGAGGGTGAAGTGGG - Intronic
1032424968 7:131815183-131815205 GCTGGTGGGGAAGGTGCAGTTGG + Intergenic
1032499753 7:132391611-132391633 CCTGCTGGGTAGCCTGGGGTTGG - Intronic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1033125170 7:138701111-138701133 GCTGCTGTAGAGGGTGGGGTGGG - Intronic
1033129750 7:138735591-138735613 GCTGCTGGGAAGCGGGGAGAAGG + Intronic
1033206250 7:139425625-139425647 GCTCCTTGGGAGGGTGAAGTGGG - Intergenic
1033243401 7:139699600-139699622 GCAGCTGGGGAGGGTGGAGCTGG + Intronic
1033760426 7:144431064-144431086 GCTACTGGGGAGACTGAAGTGGG + Intergenic
1034276954 7:149828072-149828094 GCTGCTGCAGGGCCTGGAGTAGG - Intergenic
1034419975 7:150985218-150985240 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1034473483 7:151269224-151269246 CCTGCTGGGCAGAGTGGAGTGGG + Intronic
1034636705 7:152573002-152573024 GCTACTTGGGAGGGTGAAGTAGG + Intergenic
1034825332 7:154257310-154257332 GCTGATGGGGAGGGTGTGGTTGG - Intronic
1034938760 7:155216548-155216570 GATGCTGAGGAGCCTAGAGTGGG + Intergenic
1034976769 7:155453745-155453767 TCTGCCGGGGAGCGGGGAGGGGG - Intergenic
1034989503 7:155539051-155539073 GCAGCTGGGCAGGGTGGGGTGGG - Intergenic
1035159328 7:156939841-156939863 GCTACTGGGGAGCCTGAGGTGGG - Intergenic
1036402467 8:8422236-8422258 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1036430244 8:8683144-8683166 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1036511482 8:9404303-9404325 GCTGTTGGGGTGCCTGGTGTGGG - Intergenic
1036944648 8:13083089-13083111 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1036946574 8:13100111-13100133 GCTGCTGGTCTGCGTGGAGTTGG + Exonic
1037317070 8:17609107-17609129 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1037442325 8:18928927-18928949 GCTGCTTGGGAGGCTGGAGGTGG - Intronic
1037485353 8:19341729-19341751 GCTGCTTGGGAGGCTGGGGTGGG + Intronic
1037944405 8:22977909-22977931 GCTACTGGGGAGGCTGGAGTGGG + Intronic
1038059259 8:23894110-23894132 GCTGCTCGGGAGGGTGAGGTAGG - Intergenic
1038301174 8:26350510-26350532 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1038343968 8:26714994-26715016 GCTACTGGGGAGGGTGAGGTGGG + Intergenic
1038647084 8:29370892-29370914 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1038743147 8:30233126-30233148 GCTGCTCAGGAGGCTGGAGTGGG + Intergenic
1038934463 8:32233211-32233233 GCTACTGGGGAGGCTGAAGTAGG - Intronic
1039163600 8:34650710-34650732 GCTACTTGGGAGGGTGAAGTGGG - Intergenic
1039741360 8:40385913-40385935 GCTACTCGGGAGGGTGAAGTGGG - Intergenic
1039884166 8:41646029-41646051 GCTGTTGGGGCGGGGGGAGTGGG - Exonic
1039988808 8:42470327-42470349 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1040279010 8:46028554-46028576 CCTGGTGGGGAAAGTGGAGTGGG - Intergenic
1041019633 8:53625783-53625805 GCTGCCTGGGAGTGGGGAGTTGG + Intergenic
1041810900 8:61908979-61909001 GCTGCTTGGGAGGCTGGGGTGGG + Intergenic
1042306553 8:67339499-67339521 TCTGCTAGGGAGGGTGCAGTTGG - Intronic
1042354608 8:67812799-67812821 GCTGCTTGGGAGGCTGAAGTGGG + Intergenic
1042709638 8:71702733-71702755 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1042712055 8:71728599-71728621 GCTACTGGGGAGGCTGAAGTGGG - Intergenic
1042887427 8:73567848-73567870 GCTGGGGGGGAGGGGGGAGTTGG + Intronic
1042915682 8:73873542-73873564 GCTGCTTGGGAGTCTGAAGTGGG + Intronic
1044585611 8:93866791-93866813 GCTGCTGGGGAGACTGAGGTAGG + Intronic
1045136233 8:99221818-99221840 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1045571327 8:103371626-103371648 GCTGCCGGGCAGCGCGGAGCTGG - Exonic
1045962265 8:107981920-107981942 GCTACTGGGGAGGCTGTAGTGGG + Intronic
1045986742 8:108257859-108257881 GCTACTCGGGAGGCTGGAGTGGG - Intronic
1046755400 8:117968215-117968237 GCTACTGGGGAGGTTGGGGTGGG - Intronic
1046885308 8:119360539-119360561 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1047132768 8:122039544-122039566 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1047372265 8:124265902-124265924 GCTCCTGGAGAGCAGGGAGTTGG + Intergenic
1047499019 8:125428477-125428499 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1047501678 8:125446514-125446536 GCTGCTCGGGAGGGTGAGGTGGG - Intergenic
1047672089 8:127159080-127159102 AGAGGTGGGGAGCGTGGAGTAGG - Intergenic
1048371555 8:133782878-133782900 GCTACTTGGGAGGGTGAAGTGGG - Intergenic
1048494917 8:134927075-134927097 GCTGCTGCGTAGCGAGGAGAGGG + Intergenic
1048977215 8:139679862-139679884 GCTGCAGGACAGAGTGGAGTTGG - Intronic
1049456418 8:142693310-142693332 TCTGCTGGGGAGCCTGGAGCCGG - Intergenic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049657441 8:143805014-143805036 CCTGCAGGGGAGGGTGGAGGAGG + Exonic
1049690885 8:143958361-143958383 GCTGCAGGGGAGAGAGGAGAAGG - Intronic
1049693410 8:143972609-143972631 GCTGCTGGGGAGGGTCGCGGTGG - Intronic
1049699738 8:144004852-144004874 GCTCCTGGGGTGAATGGAGTGGG + Intronic
1049765532 8:144353642-144353664 GGTGCTGGGGGCCGTGGAGAGGG - Intronic
1049794592 8:144490945-144490967 GCTACTGGGGAGGGTGAGGTGGG + Intronic
1049834446 8:144725400-144725422 GCTACTCGGGAGCCTGAAGTGGG - Intronic
1050306717 9:4312354-4312376 GCTACTGGGGAGGCTGGGGTAGG + Intronic
1050371701 9:4928674-4928696 GCTGCTTGGGAGGCTGAAGTGGG - Intergenic
1050529750 9:6578229-6578251 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1051199289 9:14598865-14598887 GCTACTTGGGAGACTGGAGTGGG - Intergenic
1051558257 9:18409269-18409291 GCTACTGGGGAGGCTGAAGTGGG + Intergenic
1052921148 9:33970540-33970562 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1052947989 9:34183880-34183902 GCTACTCGGGAGCCTGGGGTAGG - Intronic
1053098142 9:35347010-35347032 GCTGCTTGGGAGGCTGAAGTGGG - Intronic
1053883507 9:42619212-42619234 GCTGCTGGGGAGGGTGAGGCAGG + Intergenic
1053889162 9:42675087-42675109 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1054222527 9:62426679-62426701 GCTGCTGGGGAGGGTGAGGCAGG + Intergenic
1054228183 9:62482493-62482515 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1054777882 9:69139103-69139125 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1054784396 9:69197078-69197100 GCTGCTGGGGAGGGTGAAGCAGG - Intronic
1055276860 9:74627048-74627070 GCTGCTGGGGAGGCTGAGGTGGG + Intronic
1055289351 9:74766796-74766818 GCTACTGGGGAGGGTGAGGTAGG + Intronic
1055547068 9:77389415-77389437 GCTACTTGGGAGGGTGGAGCAGG - Intronic
1055685887 9:78774422-78774444 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1055730581 9:79276165-79276187 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1056236913 9:84603908-84603930 GCTACTAGGGAGCCTGAAGTGGG - Intergenic
1056569415 9:87802704-87802726 GGTGCTGGGTAGCGGGGAGGCGG - Intergenic
1056914782 9:90736647-90736669 GCTGCTGGGGAGGGTGCAGAAGG + Intergenic
1057195392 9:93113556-93113578 GCAGCTGGGGTGGGGGGAGTGGG - Intergenic
1057752544 9:97803938-97803960 CCTGCTGGGGTGAGTGGCGTCGG + Intergenic
1058018023 9:100058185-100058207 GCTACTTGGGAGGGTGAAGTGGG - Intronic
1058903448 9:109461643-109461665 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1058969434 9:110066584-110066606 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1059455151 9:114395664-114395686 TCTGCTTGGCAGCCTGGAGTTGG - Intergenic
1060220837 9:121763325-121763347 GCTGCTGGGGAGTGTGGGCAGGG - Intronic
1060400319 9:123344754-123344776 GCTGCTGGGGAGAGGGGAGGAGG + Intergenic
1060525811 9:124320683-124320705 GCTGCAGTGGAGCATGGAGCTGG - Intronic
1060645818 9:125278721-125278743 GCTGCTTGGGAGGCTGAAGTGGG + Intronic
1060727858 9:126017608-126017630 TGGGATGGGGAGCGTGGAGTGGG + Intergenic
1061267162 9:129513509-129513531 GCAGCTGGGGTGAGTGGGGTGGG - Intergenic
1061345860 9:130024336-130024358 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1061437898 9:130578382-130578404 GCTACTTGGGAGGCTGGAGTGGG - Intergenic
1061511855 9:131066555-131066577 GCTGCTGGGGATAGTGGTGATGG + Intronic
1061657994 9:132107474-132107496 GCTACTTGGGAGCCTGAAGTGGG + Intergenic
1061707075 9:132461476-132461498 GCTGCTGGGGACCAGGGAGCAGG - Intronic
1061770685 9:132918455-132918477 GTTGCTTGGGAGTGTAGAGTTGG - Intronic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1061909297 9:133714340-133714362 ACTGCAGGGGAGGGTGGAGGAGG + Intronic
1061956114 9:133962117-133962139 GCTGGTGGGCAGGGTGGGGTTGG - Intronic
1061960172 9:133983802-133983824 GGAGCCGGGGAGCGTGGGGTGGG - Intronic
1062032403 9:134367619-134367641 CCGGCTGGGGAGTGTGGGGTGGG + Intronic
1062335331 9:136062803-136062825 GCTGCTTGGGAGCCTGAGGTGGG + Intronic
1062459293 9:136656224-136656246 GGTGCTGAGGAGTGTGGACTCGG + Intergenic
1062621336 9:137423700-137423722 GCTGCGGGTGAGCGGGGCGTGGG + Exonic
1185592117 X:1284312-1284334 GCTACTTGGGAGGCTGGAGTGGG - Intronic
1185592141 X:1284537-1284559 GCTACTTGGGAGGCTGGAGTGGG - Intronic
1185860592 X:3575460-3575482 GCTGCTGGGGAGGCTGAGGTTGG - Intergenic
1185873129 X:3680960-3680982 GCTACTGGGGAGGCTGAAGTGGG + Intronic
1185953308 X:4460397-4460419 GCTGCTGGGGAGGCTGAGGTGGG + Intergenic
1186051894 X:5605064-5605086 GCTGCTTGGGAGTGTGAGGTTGG + Intergenic
1186085283 X:5982744-5982766 GCTACTGGGGAGGGTGAGGTGGG + Intronic
1186746411 X:12574607-12574629 GCTGCTGGGGAGGCTGAAGTGGG - Intronic
1186880649 X:13862796-13862818 GCTACTGGGGAGGCTGGGGTGGG - Intronic
1187087178 X:16052498-16052520 GCTGCTTGGGAGGCTGGAGCAGG + Intergenic
1187186067 X:16987019-16987041 GCTACTGGGGAGGCTGAAGTGGG - Intronic
1187988987 X:24849254-24849276 GCTGCTGGGCAGCATGGATTGGG - Intronic
1188360696 X:29249159-29249181 TCGGCTGGGGAGATTGGAGTGGG + Intronic
1188946934 X:36316895-36316917 GCTACTGGGAAGGGTGGAGTGGG - Intronic
1188970206 X:36605949-36605971 GCTACTCAGGAGGGTGGAGTGGG + Intergenic
1189236588 X:39491734-39491756 GCTGCATGGGAGGGAGGAGTTGG - Intergenic
1189496298 X:41511870-41511892 GCTACTGGGGAGGCTGGGGTGGG + Intergenic
1189904380 X:45742868-45742890 GCTGCTGGAGAGGGTGAGGTGGG + Intergenic
1189920321 X:45896932-45896954 GCTACTGGGGAGCCTGTGGTGGG - Intergenic
1190073415 X:47297627-47297649 GCTACTGGGGAGACTGGGGTGGG + Intergenic
1190120965 X:47658933-47658955 GCTCCTGGGGAGTGGGGAGGGGG + Exonic
1190231708 X:48587325-48587347 GCTGCTGGGGAGGCTGAGGTGGG - Intergenic
1190470751 X:50776798-50776820 GCTGCTTGGGAGCTTGGGGTGGG - Intronic
1190743068 X:53303089-53303111 GCTACTTGGGAGGCTGGAGTGGG + Intronic
1190908284 X:54749638-54749660 GCTGGTGAGGAGCATGGATTTGG + Exonic
1191834970 X:65454473-65454495 GCAGCTGGGAAGCGTGAACTGGG + Intronic
1192162809 X:68801251-68801273 CCTGCAGGGGAGGGTGGAGGTGG + Intergenic
1192180888 X:68914848-68914870 GCTGCTGAGGAGCTGCGAGTGGG + Intergenic
1192295765 X:69846404-69846426 GCTGCTCGGGAGGCTGAAGTGGG - Intronic
1193469172 X:81878427-81878449 ACTGCTGGCCAGCCTGGAGTTGG + Intergenic
1194481443 X:94430859-94430881 GCTGCTTGGGAGGCTGAAGTAGG - Intergenic
1195940060 X:110160591-110160613 GCTGCTGGGGTGCAGGGGGTGGG + Intronic
1196190353 X:112788175-112788197 GCTGCTTGGGAGGCTGAAGTAGG + Intronic
1196775512 X:119333743-119333765 GCGGCTGGGGAGGGTGTACTGGG + Intergenic
1196904160 X:120415819-120415841 GCTGCTTGGGAGCCTGGGGTGGG - Intergenic
1197105089 X:122703809-122703831 CCTGCTGGGCTGCTTGGAGTCGG - Intergenic
1197842364 X:130762468-130762490 GCTACTGGGGAGGGTGAAGTGGG + Intronic
1199981994 X:152926122-152926144 GCGTCTGGGGAGCAGGGAGTAGG + Intronic
1200119041 X:153781848-153781870 GCTCCAGGGGAGCTGGGAGTGGG - Intronic
1200161289 X:154011194-154011216 GCTGCTGGGGAGGCTGAAGTAGG - Exonic
1200177188 X:154125474-154125496 GCTGCTGCGGAGCGGGGGCTGGG - Intergenic
1200690802 Y:6305462-6305484 GCTGCTGGGGCGAGGGCAGTGGG + Intergenic
1201044470 Y:9869254-9869276 GCTGCTGGGGCGAGGGCAGTGGG - Intergenic
1201553496 Y:15243688-15243710 GCTGCTTGGGAGGCTGGGGTGGG + Intergenic