ID: 1122658614

View in Genome Browser
Species Human (GRCh38)
Location 14:103279435-103279457
Sequence GCACACGCCCGGGAGCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658614_1122658625 28 Left 1122658614 14:103279435-103279457 CCGCGGTGCTCCCGGGCGTGTGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658614_1122658620 4 Left 1122658614 14:103279435-103279457 CCGCGGTGCTCCCGGGCGTGTGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1122658620 14:103279462-103279484 AGGCCTCGTTCCGGGCCGTGAGG 0: 1
1: 1
2: 0
3: 4
4: 69
1122658614_1122658619 -4 Left 1122658614 14:103279435-103279457 CCGCGGTGCTCCCGGGCGTGTGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1122658619 14:103279454-103279476 GTGCAGCGAGGCCTCGTTCCGGG No data
1122658614_1122658618 -5 Left 1122658614 14:103279435-103279457 CCGCGGTGCTCCCGGGCGTGTGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1122658618 14:103279453-103279475 TGTGCAGCGAGGCCTCGTTCCGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658614 Original CRISPR GCACACGCCCGGGAGCACCG CGG (reversed) Intergenic