ID: 1122658617

View in Genome Browser
Species Human (GRCh38)
Location 14:103279446-103279468
Sequence GAGGCCTCGCTGCACACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658617_1122658625 17 Left 1122658617 14:103279446-103279468 CCGGGCGTGTGCAGCGAGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658617_1122658620 -7 Left 1122658617 14:103279446-103279468 CCGGGCGTGTGCAGCGAGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1122658620 14:103279462-103279484 AGGCCTCGTTCCGGGCCGTGAGG 0: 1
1: 1
2: 0
3: 4
4: 69
1122658617_1122658628 24 Left 1122658617 14:103279446-103279468 CCGGGCGTGTGCAGCGAGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1122658628 14:103279493-103279515 CAAGCGCCTGCGCCGGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1122658617_1122658627 23 Left 1122658617 14:103279446-103279468 CCGGGCGTGTGCAGCGAGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1122658627 14:103279492-103279514 GCAAGCGCCTGCGCCGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658617 Original CRISPR GAGGCCTCGCTGCACACGCC CGG (reversed) Intergenic