ID: 1122658621

View in Genome Browser
Species Human (GRCh38)
Location 14:103279465-103279487
Sequence CGGCCTCACGGCCCGGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 52}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658621_1122658635 25 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658635 14:103279513-103279535 GGGAACCCGGGGCCGTCCCGCGG 0: 1
1: 0
2: 3
3: 11
4: 125
1122658621_1122658627 4 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658627 14:103279492-103279514 GCAAGCGCCTGCGCCGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 97
1122658621_1122658636 26 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658636 14:103279514-103279536 GGAACCCGGGGCCGTCCCGCGGG 0: 1
1: 1
2: 0
3: 8
4: 106
1122658621_1122658631 13 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658631 14:103279501-103279523 TGCGCCGGCCGTGGGAACCCGGG 0: 1
1: 0
2: 2
3: 6
4: 123
1122658621_1122658632 14 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658632 14:103279502-103279524 GCGCCGGCCGTGGGAACCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 97
1122658621_1122658630 12 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658630 14:103279500-103279522 CTGCGCCGGCCGTGGGAACCCGG 0: 1
1: 0
2: 1
3: 7
4: 83
1122658621_1122658625 -2 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658621_1122658628 5 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658628 14:103279493-103279515 CAAGCGCCTGCGCCGGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658621 Original CRISPR CGGCCTCACGGCCCGGAACG AGG (reversed) Intergenic