ID: 1122658622

View in Genome Browser
Species Human (GRCh38)
Location 14:103279472-103279494
Sequence TGCTCGGCGGCCTCACGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658622_1122658640 28 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658640 14:103279523-103279545 GGCCGTCCCGCGGGTGCTGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1122658622_1122658641 29 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658641 14:103279524-103279546 GCCGTCCCGCGGGTGCTGGTGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1122658622_1122658631 6 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658631 14:103279501-103279523 TGCGCCGGCCGTGGGAACCCGGG 0: 1
1: 0
2: 2
3: 6
4: 123
1122658622_1122658632 7 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658632 14:103279502-103279524 GCGCCGGCCGTGGGAACCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 97
1122658622_1122658636 19 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658636 14:103279514-103279536 GGAACCCGGGGCCGTCCCGCGGG 0: 1
1: 1
2: 0
3: 8
4: 106
1122658622_1122658639 25 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658639 14:103279520-103279542 CGGGGCCGTCCCGCGGGTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 156
1122658622_1122658628 -2 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658628 14:103279493-103279515 CAAGCGCCTGCGCCGGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1122658622_1122658627 -3 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658627 14:103279492-103279514 GCAAGCGCCTGCGCCGGCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 97
1122658622_1122658625 -9 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658622_1122658630 5 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658630 14:103279500-103279522 CTGCGCCGGCCGTGGGAACCCGG 0: 1
1: 0
2: 1
3: 7
4: 83
1122658622_1122658635 18 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658635 14:103279513-103279535 GGGAACCCGGGGCCGTCCCGCGG 0: 1
1: 0
2: 3
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658622 Original CRISPR TGCTCGGCGGCCTCACGGCC CGG (reversed) Intergenic