ID: 1122658625

View in Genome Browser
Species Human (GRCh38)
Location 14:103279486-103279508
Sequence CGCCGAGCAAGCGCCTGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122658621_1122658625 -2 Left 1122658621 14:103279465-103279487 CCTCGTTCCGGGCCGTGAGGCCG 0: 1
1: 1
2: 0
3: 4
4: 52
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658614_1122658625 28 Left 1122658614 14:103279435-103279457 CCGCGGTGCTCCCGGGCGTGTGC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658617_1122658625 17 Left 1122658617 14:103279446-103279468 CCGGGCGTGTGCAGCGAGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658616_1122658625 18 Left 1122658616 14:103279445-103279467 CCCGGGCGTGTGCAGCGAGGCCT No data
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1122658622_1122658625 -9 Left 1122658622 14:103279472-103279494 CCGGGCCGTGAGGCCGCCGAGCA 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1122658625 14:103279486-103279508 CGCCGAGCAAGCGCCTGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122658625 Original CRISPR CGCCGAGCAAGCGCCTGCGC CGG Intergenic