ID: 1122662762

View in Genome Browser
Species Human (GRCh38)
Location 14:103309093-103309115
Sequence CTGGGCAAAGCGAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122662756_1122662762 -2 Left 1122662756 14:103309072-103309094 CCAGGATGCTTTGTTGAGATGCT No data
Right 1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122662762 Original CRISPR CTGGGCAAAGCGAGGGTGGC TGG Intergenic
No off target data available for this crispr