ID: 1122663775

View in Genome Browser
Species Human (GRCh38)
Location 14:103315263-103315285
Sequence TATGGTTCGAAGGATGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122663775_1122663783 27 Left 1122663775 14:103315263-103315285 CCACCAGCATCCTTCGAACCATA No data
Right 1122663783 14:103315313-103315335 CCCAATTCTAACTTTCTTATGGG No data
1122663775_1122663779 4 Left 1122663775 14:103315263-103315285 CCACCAGCATCCTTCGAACCATA No data
Right 1122663779 14:103315290-103315312 ATCAAATTAAAACAAGCCATTGG No data
1122663775_1122663781 26 Left 1122663775 14:103315263-103315285 CCACCAGCATCCTTCGAACCATA No data
Right 1122663781 14:103315312-103315334 GCCCAATTCTAACTTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122663775 Original CRISPR TATGGTTCGAAGGATGCTGG TGG (reversed) Intergenic
No off target data available for this crispr