ID: 1122666368

View in Genome Browser
Species Human (GRCh38)
Location 14:103333472-103333494
Sequence AGCGCGTCGCCTCCCGTTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122666368_1122666375 20 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666375 14:103333515-103333537 GTTGCGGGCCGACACCGAGGCGG No data
1122666368_1122666372 4 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666372 14:103333499-103333521 TAAGCGCGCAGGCTGGGTTGCGG No data
1122666368_1122666376 25 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666376 14:103333520-103333542 GGGCCGACACCGAGGCGGCGCGG No data
1122666368_1122666374 17 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666374 14:103333512-103333534 TGGGTTGCGGGCCGACACCGAGG No data
1122666368_1122666371 -2 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666371 14:103333493-103333515 CTGAGCTAAGCGCGCAGGCTGGG No data
1122666368_1122666370 -3 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666370 14:103333492-103333514 GCTGAGCTAAGCGCGCAGGCTGG No data
1122666368_1122666369 -7 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666369 14:103333488-103333510 ACGCGCTGAGCTAAGCGCGCAGG No data
1122666368_1122666373 5 Left 1122666368 14:103333472-103333494 CCGAAAACGGGAGGCGACGCGCT No data
Right 1122666373 14:103333500-103333522 AAGCGCGCAGGCTGGGTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122666368 Original CRISPR AGCGCGTCGCCTCCCGTTTT CGG (reversed) Intergenic
No off target data available for this crispr