ID: 1122666704

View in Genome Browser
Species Human (GRCh38)
Location 14:103334762-103334784
Sequence GCTCCCGCCATGCCGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122666704_1122666711 2 Left 1122666704 14:103334762-103334784 CCCCTCCCCGGCATGGCGGGAGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1122666711 14:103334787-103334809 GTCGCGCGTGCCCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1122666704_1122666710 1 Left 1122666704 14:103334762-103334784 CCCCTCCCCGGCATGGCGGGAGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1122666710 14:103334786-103334808 CGTCGCGCGTGCCCGCCGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 38
1122666704_1122666713 12 Left 1122666704 14:103334762-103334784 CCCCTCCCCGGCATGGCGGGAGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1122666713 14:103334797-103334819 CCCGCCGCTCGGGCTGACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122666704 Original CRISPR GCTCCCGCCATGCCGGGGAG GGG (reversed) Intronic