ID: 1122666704

View in Genome Browser
Species Human (GRCh38)
Location 14:103334762-103334784
Sequence GCTCCCGCCATGCCGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122666704_1122666710 1 Left 1122666704 14:103334762-103334784 CCCCTCCCCGGCATGGCGGGAGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1122666710 14:103334786-103334808 CGTCGCGCGTGCCCGCCGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 38
1122666704_1122666711 2 Left 1122666704 14:103334762-103334784 CCCCTCCCCGGCATGGCGGGAGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1122666711 14:103334787-103334809 GTCGCGCGTGCCCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1122666704_1122666713 12 Left 1122666704 14:103334762-103334784 CCCCTCCCCGGCATGGCGGGAGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1122666713 14:103334797-103334819 CCCGCCGCTCGGGCTGACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122666704 Original CRISPR GCTCCCGCCATGCCGGGGAG GGG (reversed) Intronic
900180773 1:1310025-1310047 CCTCCCCCCAGGCTGGGGAGCGG + Intronic
900314598 1:2050568-2050590 GCTCCGGCCATGGCGCGGGGCGG - Exonic
903065629 1:20697760-20697782 GCCCCCGCCATGCCTGGCTGTGG + Intronic
906142942 1:43544515-43544537 TCTCCCTCCCTGCTGGGGAGAGG + Intronic
909231650 1:73099607-73099629 GCTGCCCCCAAGCTGGGGAGCGG + Intergenic
922586286 1:226737083-226737105 CCTCCGGCCCTGGCGGGGAGAGG + Exonic
922720205 1:227896439-227896461 GCCTCCGCCCTGCCCGGGAGGGG + Intergenic
923497014 1:234534566-234534588 ACTCCCGCCCTTCAGGGGAGGGG + Intergenic
1065092840 10:22252488-22252510 GGAACCGCCAGGCCGGGGAGGGG - Intergenic
1065312310 10:24428200-24428222 GCCCCAGCCATGCCTGGGCGAGG - Intronic
1068354838 10:55897548-55897570 GCTCCAGCCATGGCTGAGAGGGG - Intergenic
1069857943 10:71451942-71451964 GCTCCCGACATGCCCTGGGGAGG - Intronic
1070915364 10:80150828-80150850 GCTGCTGCCATGCTGGGGAGTGG + Intergenic
1074860277 10:117504767-117504789 GCTCCCGCCCTGCCGATGGGAGG + Intergenic
1075999820 10:126905653-126905675 GCGGCCGCCGGGCCGGGGAGAGG + Intronic
1076371575 10:129959227-129959249 GCGCCCGCCAGGCCTGCGAGGGG + Intronic
1077230633 11:1456856-1456878 GGTCCCGCCAGGCCAGGGAGGGG - Intronic
1080878290 11:36296390-36296412 GGTCCCACCTTGCTGGGGAGAGG - Intronic
1081808527 11:45902721-45902743 GCGGCCGCCCTGCCGTGGAGGGG - Exonic
1082774844 11:57236994-57237016 CCTTCCTCCATGCTGGGGAGTGG + Exonic
1083714423 11:64567553-64567575 GTCCCTGCCCTGCCGGGGAGAGG - Intronic
1083897187 11:65625770-65625792 GCTCCCGCCAAGACAGCGAGAGG - Intronic
1085561266 11:77474204-77474226 GCCGCCGCCGCGCCGGGGAGGGG - Intronic
1086534188 11:87824122-87824144 CCTCCCACCATGCTGGGGAAGGG - Intergenic
1091178295 11:133580930-133580952 GCTCCAGCCAGGCCAAGGAGAGG + Intergenic
1091284214 11:134399104-134399126 GCTCCCATCATGCAGGCGAGAGG - Intronic
1092441361 12:8508175-8508197 GCTGCCCCCAAGCAGGGGAGGGG - Intergenic
1101827772 12:108233805-108233827 TCTCCCACCATGCCCAGGAGAGG - Intronic
1103276008 12:119712454-119712476 GTTACCGCCAAGGCGGGGAGCGG + Intronic
1114462053 14:22892710-22892732 GCTCCCGCCAGACTTGGGAGAGG + Intergenic
1114687582 14:24548539-24548561 GCTCCAGCCATGGCTGAGAGAGG - Intergenic
1115993213 14:39170553-39170575 GCTCCCGCCTGGCCCGGGCGCGG + Intergenic
1117377455 14:55129329-55129351 GCTCCGGCCGGGCAGGGGAGAGG + Intronic
1119743417 14:77028163-77028185 GCACCAGCCACTCCGGGGAGGGG - Exonic
1121012982 14:90532924-90532946 CCTCCTGCCATGCCCGGGGGAGG + Exonic
1121595128 14:95156903-95156925 GGCCTCGCCAGGCCGGGGAGTGG + Intronic
1122666704 14:103334762-103334784 GCTCCCGCCATGCCGGGGAGGGG - Intronic
1122863221 14:104591785-104591807 GCGCCCACCTTCCCGGGGAGAGG - Intronic
1124628896 15:31326338-31326360 GCCCCCGGCATGGAGGGGAGCGG - Intergenic
1124662748 15:31563545-31563567 GCTGGAGCCATGCTGGGGAGAGG - Intronic
1128743041 15:70096477-70096499 GCCCCCGCCTTACTGGGGAGAGG - Intronic
1129666461 15:77582154-77582176 GCCCCCGCCATGGGGGTGAGTGG + Intergenic
1132467826 16:85668-85690 GCGTCGGCCATGCAGGGGAGTGG + Exonic
1132611244 16:817314-817336 GCTCCGGCCAAGGCTGGGAGGGG + Intergenic
1132932999 16:2468213-2468235 GCGCCCGCCCGGCCGGGGCGAGG - Intergenic
1136129483 16:28211259-28211281 GCTCTCCCCATGGCGGGGAGAGG - Intronic
1136254544 16:29029401-29029423 GCTCCCGGCAGCCGGGGGAGGGG + Intergenic
1137665385 16:50246333-50246355 GCACCCGCGAGGCCGGGGAAGGG - Intronic
1138561310 16:57802362-57802384 GCCTCCGCCAGGCCGGTGAGTGG - Exonic
1141548263 16:84786833-84786855 GCCCCTGCCATGCCTGGGGGAGG + Intergenic
1141985439 16:87576840-87576862 GCTTCCCCCATGTCAGGGAGTGG + Intergenic
1142120238 16:88383381-88383403 GGTCCGGCCCCGCCGGGGAGCGG - Intergenic
1142145282 16:88490480-88490502 GCGCTCGCCGTGCTGGGGAGCGG + Intronic
1142758562 17:2029906-2029928 GCTCGTGCCCGGCCGGGGAGAGG + Intergenic
1143527143 17:7479370-7479392 GCTCCCGCAGCGCCGGGCAGCGG + Intronic
1143586899 17:7854937-7854959 GCACCCCCCATCCCGAGGAGCGG - Intergenic
1146000380 17:29127064-29127086 GCACCCACCATGCCAGGGACCGG + Intronic
1147753793 17:42754779-42754801 GCTCCTGGCATGCCGGGATGGGG + Intergenic
1147966076 17:44194889-44194911 GCTCCTGCCTTGCCGAGGGGAGG - Intronic
1148460974 17:47838809-47838831 GCTCCCGCCCTGCCTGGAAGCGG + Exonic
1150830311 17:68512676-68512698 GCGCCCGCCGGGCCGGGGAGGGG - Intronic
1151585250 17:75004696-75004718 GCTCCAGCCCTGCCAGGGACAGG + Exonic
1151780033 17:76239897-76239919 GCTCCCGTCCTCCCGTGGAGGGG + Intronic
1151919063 17:77140597-77140619 GCTGCCGGCGTGCAGGGGAGGGG - Intronic
1152474899 17:80511859-80511881 GCTCCCACCAGCCCAGGGAGAGG - Intergenic
1156459382 18:37313115-37313137 GCACCCTCCATGCTGGGGTGGGG + Intronic
1160752314 19:740270-740292 GCTGCGGCCAAGCCAGGGAGGGG - Intronic
1160871203 19:1278715-1278737 GGGCCCGCCCTGCCGGGCAGAGG - Intronic
1162393749 19:10404608-10404630 GCTCCAGCCACTCCGGTGAGGGG + Intronic
1163019713 19:14475561-14475583 GCTCCCGCCCTGCTGGGAGGAGG - Intergenic
1164617805 19:29677186-29677208 GTTCCAGCCCTGCAGGGGAGAGG - Intergenic
1165310473 19:35026526-35026548 GATCCTGCCATGGTGGGGAGGGG + Intergenic
1167074288 19:47239609-47239631 GCCCCCGCCCCGCCGGGAAGCGG - Intergenic
1167135601 19:47613438-47613460 TCTCCCGCCCTGCAGGGGAGAGG + Intronic
1167348575 19:48961829-48961851 TCTCCTGACGTGCCGGGGAGCGG - Intergenic
1168145900 19:54420173-54420195 GGTGCTGCCCTGCCGGGGAGGGG - Intronic
927181078 2:20447203-20447225 GCTCACCCCAGGCCGGGGATCGG - Exonic
927190271 2:20512435-20512457 GCTCCCGCCATGGCGGAGTTGGG - Intergenic
927501684 2:23587505-23587527 GCTCCTGCCAGGCAGTGGAGGGG - Intronic
933791737 2:85888787-85888809 GCCCCCGCGACGCCGAGGAGGGG + Intronic
936079684 2:109423742-109423764 GGTGCCGCCATGCCTGGAAGGGG - Intronic
937208646 2:120253063-120253085 GCTCCCTCCGTGCCGGGCTGTGG + Intronic
938228442 2:129637383-129637405 GGTCCAGCCAGGCAGGGGAGCGG + Intergenic
938405861 2:131032757-131032779 GCTCCCACCAGGGAGGGGAGTGG - Intronic
940420768 2:153477735-153477757 GCTCCCCCCCTGCCCTGGAGGGG - Exonic
942046336 2:172101434-172101456 GCTCGCGCCCTGCAGGGGCGAGG - Intronic
945879635 2:215312287-215312309 GCTGCGGCCCGGCCGGGGAGCGG - Intronic
947049992 2:226031223-226031245 GCTCCCGTGCGGCCGGGGAGAGG - Intergenic
1172303712 20:33866759-33866781 GCTGCCGCCCTGCCCTGGAGGGG - Intergenic
1174431740 20:50475116-50475138 GCTCCTGCCATGCCCTGCAGAGG - Intergenic
1176075855 20:63247925-63247947 GCTCCAGCCATGGTGGGGAAAGG + Intronic
1176179627 20:63743151-63743173 CCCCCCGCCAGGTCGGGGAGGGG + Exonic
1179375426 21:40846669-40846691 GCTCGCGGGAGGCCGGGGAGCGG - Exonic
1179717573 21:43297732-43297754 CCTCCAGGCATGCCAGGGAGGGG + Intergenic
1181646109 22:24232525-24232547 CCTCCTGCCATGCCAGAGAGAGG + Intronic
1182101788 22:27662818-27662840 GCCCCAGCCAGGCCGGGGAAGGG + Intergenic
1182417865 22:30232950-30232972 GCTGCAGCCAGGCCGGGGGGAGG - Intergenic
1183704589 22:39469034-39469056 GCTGCTGCCATTCCGGTGAGCGG + Intronic
1184688810 22:46108290-46108312 GCTGCGGGCATGCTGGGGAGGGG + Intronic
1185190459 22:49433088-49433110 GCCCTCTCCCTGCCGGGGAGAGG + Intronic
950448796 3:13054220-13054242 GCCCCAGCCATGCCGGGAATTGG - Intronic
950509154 3:13415358-13415380 GCTCCCGCAGGGCCTGGGAGAGG - Intronic
951199736 3:19863324-19863346 GCTCCAGCCATGACCGGGAGGGG - Intergenic
955769592 3:62374057-62374079 GCCCCCGAGATGCCGGCGAGCGG - Intronic
958635340 3:96737544-96737566 GCTCCCAACATGCCAGGGAAAGG + Intergenic
964654537 3:159051990-159052012 GCTCCAGCCATGGCTGAGAGGGG + Intronic
966932571 3:184685395-184685417 CCTCCCACCACGCCGGGAAGAGG - Intergenic
967009494 3:185418768-185418790 GCACACGCCATGGCGGAGAGAGG + Intronic
967054945 3:185823762-185823784 GCTCCCGCCGGGCCGGGGTTCGG + Intronic
968051156 3:195655963-195655985 GGTCCCGCCATGCTGGAAAGTGG + Intergenic
968085268 3:195871291-195871313 GCTCACTCCATACCTGGGAGAGG - Intronic
968104669 3:195992375-195992397 GGTCCCGCCATGCTGGAAAGTGG - Intergenic
968302959 3:197629958-197629980 GGTCCCGCCATGCTGGAAAGTGG - Intergenic
968985765 4:3873570-3873592 ACTCCAGCCATACAGGGGAGTGG - Intergenic
969496604 4:7529911-7529933 CCCCCCGCCATCCTGGGGAGGGG + Intronic
975883569 4:78939267-78939289 GGTCCCGCCTCCCCGGGGAGGGG + Exonic
978324358 4:107535353-107535375 GCTCCTGCCATGCCTGGCAGTGG + Intergenic
985507838 5:294608-294630 GGTCCCGCCATGCTGGAAAGTGG + Intronic
985721145 5:1489899-1489921 GCTCCCGCCAGGCAGGGCTGAGG + Intronic
985740197 5:1611063-1611085 GGTCCCGCCATGCTGGAAAGTGG - Intergenic
992204203 5:74414435-74414457 GCTCCCCCCAACCCAGGGAGGGG + Intergenic
995047823 5:107670764-107670786 GCGCCCACCAAGCTGGGGAGGGG + Exonic
996379148 5:122845868-122845890 GCAGCCGCCGTGCCCGGGAGGGG - Intronic
998601801 5:143592473-143592495 GCTTCCTCCATGCAGGGGATGGG - Intergenic
999640890 5:153672182-153672204 GGTCATGCCATGCAGGGGAGAGG + Intronic
1000062895 5:157672016-157672038 TCTCCCGCGATTCCGGGGCGAGG - Intronic
1001333982 5:170782892-170782914 GCTCCAGCCATGCAGGTAAGGGG - Exonic
1008219843 6:48842651-48842673 GCTGCCTCCAAGCTGGGGAGGGG - Intergenic
1012189122 6:96259794-96259816 GCTCCCTCCATGGTGGGGAGTGG - Intergenic
1015827845 6:137335024-137335046 GCACATGCCATGCTGGGGAGCGG - Intergenic
1018687274 6:166313462-166313484 CTTCCCTCCATGCCGGGGGGGGG + Intergenic
1019275602 7:173892-173914 GCTCCATGCATGCCAGGGAGAGG + Intergenic
1019667077 7:2257302-2257324 GGTCCCACCATGGCCGGGAGGGG + Intronic
1020046794 7:5046343-5046365 GCTCCCGAGAGGCCGGGGCGGGG - Exonic
1020782718 7:12536361-12536383 GCTCCAGCCATGGCTGGAAGAGG - Intergenic
1021411158 7:20331048-20331070 GCTCCCTCCCTGGCGGGGAGTGG - Intronic
1023907393 7:44532151-44532173 GCCCCCGCCTGGCCAGGGAGAGG - Exonic
1024276330 7:47679979-47680001 GTTCAGGCCATGACGGGGAGAGG + Intergenic
1027029044 7:74875021-74875043 GCTCCCGGCAGGCCCGGGTGGGG - Intergenic
1027121804 7:75527596-75527618 GCTCCCGAGAGGCCGGGGCGGGG + Intergenic
1028011401 7:85648914-85648936 GCTCCAGCCATGGCTGAGAGGGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028382218 7:90212010-90212032 GCGCCCTCCACGCCGGGCAGGGG - Exonic
1029170122 7:98624612-98624634 GCTCCTGCTAAGACGGGGAGTGG - Intronic
1034068033 7:148155549-148155571 GCTCCCACCCTCCCGTGGAGGGG + Intronic
1035727518 8:1833999-1834021 GCTCCAGCCCTCCCGGGGAAGGG + Intronic
1036930458 8:12951503-12951525 GCGCCCGCCCCGCCGGGGACGGG - Intronic
1039968672 8:42303038-42303060 CCTCTCGGCAAGCCGGGGAGGGG - Intronic
1040607250 8:48946373-48946395 GCTGCAGCCAGGCCGGGGAAGGG - Intergenic
1042483661 8:69329594-69329616 GGTCCCGCCATGCTGGAAAGTGG + Intergenic
1043502702 8:80873493-80873515 GGACCCGCCAGCCCGGGGAGGGG - Intronic
1049611567 8:143558469-143558491 GCTCCAGCCAGGCCGGGGGAGGG - Intronic
1049644117 8:143728452-143728474 GTTCCCGCCACCCCGGGAAGAGG - Exonic
1056167910 9:83956608-83956630 GGTCCCGCCCTGCCAGGGAGTGG + Exonic
1057294674 9:93828136-93828158 GCTCCCACCCTCCTGGGGAGGGG + Intergenic
1059568423 9:115407770-115407792 CCTCCAGACATGCTGGGGAGAGG - Intergenic
1059859161 9:118438590-118438612 GCTCCCACCATGCCTGGCACAGG - Intergenic
1060464470 9:123890474-123890496 CCTCCCGCCAAGCCTGTGAGGGG + Intronic
1061807666 9:133145384-133145406 GCCCAGGCCATGCCGGGGCGGGG - Intronic
1062319611 9:135984352-135984374 GCGCCCCCCATGCCTGGCAGTGG + Intergenic
1062549859 9:137080958-137080980 GCGACAGCCATGCTGGGGAGGGG + Intronic
1062578927 9:137221296-137221318 GGTCCCGCCAGGCCTGGGGGGGG + Exonic
1185736450 X:2500354-2500376 GCCCCCGCCAGGCCCCGGAGGGG - Intronic
1189308626 X:40005489-40005511 GCGCCCGCTATTCCCGGGAGGGG - Intergenic
1193482418 X:82044080-82044102 GCTCCAGCCATGCCTGAAAGGGG + Intergenic
1197198913 X:123732382-123732404 CCTCTCGCCCTCCCGGGGAGCGG - Intronic
1200152223 X:153956827-153956849 CCTCCCGACAGGCCTGGGAGGGG - Intronic