ID: 1122667110

View in Genome Browser
Species Human (GRCh38)
Location 14:103338205-103338227
Sequence TGCTGTGTGGTTTTTCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 604}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122667106_1122667110 -2 Left 1122667106 14:103338184-103338206 CCTCTTAGGTAGCATTGTGTGTG 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1122667110 14:103338205-103338227 TGCTGTGTGGTTTTTCTGAGGGG 0: 1
1: 0
2: 5
3: 31
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122667110 Original CRISPR TGCTGTGTGGTTTTTCTGAG GGG Intronic
901923394 1:12551644-12551666 TGCTGGGTGATTTTCCAGAGTGG - Intergenic
902275303 1:15335199-15335221 TGCTGTGTGGTTCAGCTGGGAGG + Intronic
903370743 1:22834223-22834245 TTCTGTGTGGTAAATCTGAGGGG - Intronic
903484262 1:23677900-23677922 TGCTGTTGGGTCTTACTGAGGGG - Intergenic
903607982 1:24588935-24588957 TGCTTTGTGGATTTGCTGGGAGG + Intronic
904015885 1:27420296-27420318 TGCTATGTTGTTTTTCAGAGAGG - Intronic
904600301 1:31669211-31669233 AGATGTGTGCTTATTCTGAGGGG + Intronic
908433395 1:64080952-64080974 TGCTGTGTGGGGATTCTCAGAGG - Intronic
908689963 1:66767867-66767889 TGTTGTGTGGAAATTCTGAGAGG - Intronic
909175367 1:72350629-72350651 TGATGAGTGATTTTCCTGAGAGG - Intergenic
909719069 1:78745466-78745488 GGCTGTGAGGGTTTTGTGAGAGG - Intergenic
910128707 1:83876245-83876267 TGGTTTATGGTTTTTCTGAATGG + Intronic
910422476 1:87081153-87081175 TTCTTTGTGGTTTTTCTGTCTGG - Intronic
913931774 1:124976709-124976731 TTCTGTCTAGTTTTTCTGGGAGG + Intergenic
913931805 1:124977391-124977413 TTCTGTCTAGTTTTTCTGTGAGG + Intergenic
914429305 1:147605701-147605723 TATTGTGTACTTTTTCTGAGAGG + Intronic
914444119 1:147735075-147735097 GGCTTGGTGGTTTTCCTGAGTGG + Intergenic
915097594 1:153474368-153474390 GTCTGTGTGGGTTTTGTGAGTGG - Intergenic
916609939 1:166381817-166381839 AGATGTGTGGTTTGTCTGGGAGG + Intergenic
918136555 1:181679414-181679436 TGCTCTGTGCATTTTCCGAGGGG - Intronic
919254212 1:195099970-195099992 TTCAGTGTGGTTTTTTTTAGTGG + Intergenic
919380678 1:196856692-196856714 AGCTGTGTTATTTTTCTGTGCGG + Intronic
921270694 1:213466809-213466831 TGGGCTGTGGTTTTTCTGACAGG + Intergenic
921403741 1:214755602-214755624 TGCAGTGTGGTCATTTTGAGTGG + Intergenic
924700170 1:246443449-246443471 TGCTGAATCGCTTTTCTGAGAGG - Intronic
1062977738 10:1698008-1698030 AGGTGTGTAGTTTTTCTGACAGG - Intronic
1065643719 10:27812930-27812952 TGCTGTTGGCTTGTTCTGAGAGG - Intronic
1065981082 10:30897894-30897916 TGCTGTGTGATTGTTGTTAGAGG - Intronic
1066814476 10:39387566-39387588 TGCAAAGGGGTTTTTCTGAGCGG - Intergenic
1066819987 10:39473274-39473296 TTCTGTGTAGTTTTTGTGTGAGG + Intergenic
1066933339 10:41795476-41795498 TTCTGTCTGGTTTTTATGTGAGG - Intergenic
1069725585 10:70575795-70575817 TGCTGGGTGGTCATTCTGACAGG + Intergenic
1071036856 10:81258110-81258132 TGGTGTCTGGATTTACTGAGAGG + Intergenic
1071290701 10:84186849-84186871 TGGTGTGTGGTTTGTGTGTGTGG + Intergenic
1071290728 10:84187153-84187175 TGGTGTGTGGTTTGTGTGTGTGG + Intergenic
1072411104 10:95202757-95202779 TGCTTTGTGTTTTTTTTTAGTGG - Intronic
1073277702 10:102326849-102326871 TTCTGTTTTGCTTTTCTGAGTGG + Intronic
1073799183 10:107022750-107022772 TGCTGTGTTGTTCTTCTGACTGG - Intronic
1075319742 10:121481280-121481302 TGACATGTGGTTTTGCTGAGAGG + Intronic
1075347002 10:121690060-121690082 TGTTGTCTGGATTTCCTGAGAGG - Intergenic
1075380920 10:122017869-122017891 TCTTCTGTGGTTTTTTTGAGGGG + Intronic
1079045472 11:17098569-17098591 TGCTTTGTGGTTTTGCCCAGGGG + Intronic
1079253049 11:18801583-18801605 TGCTCTGTTGTTTTTCTTAAAGG + Intergenic
1079299463 11:19264752-19264774 TGCTGTCTTGTGTTTCTAAGTGG + Intergenic
1082154864 11:48796275-48796297 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
1082253539 11:50007891-50007913 TGCTGTGTCGTTGTTCTCATTGG - Intergenic
1082318857 11:50770852-50770874 TTCTGTCTGGTTTTTATGTGAGG + Intergenic
1082322525 11:51093287-51093309 TTCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082322696 11:51095838-51095860 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082325670 11:51138569-51138591 TTCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082333148 11:51247032-51247054 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082351690 11:51516339-51516361 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082359499 11:51630446-51630468 TTCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082443760 11:52851204-52851226 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082459606 11:53081586-53081608 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082475974 11:53318127-53318149 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082479966 11:53375941-53375963 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082499665 11:53659129-53659151 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1082530937 11:54111626-54111648 TCCTGTTTAGTTTTTCTGTGAGG - Intergenic
1083957920 11:65996491-65996513 TGAAGTTTGTTTTTTCTGAGAGG - Intergenic
1084290690 11:68164339-68164361 TGCGGAGTGCTTTTTCTGTGTGG - Intronic
1084329326 11:68421311-68421333 TGCTGTGTTGTTTTTGTGCCCGG + Intronic
1084788470 11:71458015-71458037 TTGTGGGTGGTTTTTCTGAATGG + Intronic
1086144827 11:83540312-83540334 GGCTGTGTGTGTTTTCTGAAAGG - Intronic
1089262855 11:117234180-117234202 TGTTGTGTGGACATTCTGAGGGG + Intronic
1089719834 11:120405444-120405466 TCCTGTTTTGTTTTTCTGGGGGG - Intronic
1089989970 11:122850071-122850093 TTCTGTGTGGTTAGTCAGAGAGG - Exonic
1092685745 12:11043682-11043704 TTATGTGTGGCTTTTGTGAGTGG - Intronic
1093914003 12:24779895-24779917 GAGTTTGTGGTTTTTCTGAGTGG + Intergenic
1095399239 12:41795582-41795604 AGCTGTGCTGCTTTTCTGAGAGG - Intergenic
1095513949 12:42985119-42985141 TTCTGAGTGTTTATTCTGAGTGG - Intergenic
1095742532 12:45622819-45622841 TGCTGTGTGGTGGCTCTGAGAGG - Intergenic
1097426092 12:59446355-59446377 TGCTGTCTGGGTTTGCGGAGGGG + Intergenic
1097977589 12:65704483-65704505 TTCTGTGTTGATTTTCTGATTGG + Intergenic
1099166886 12:79317811-79317833 TGCTGTGGGTTTTTCCTTAGGGG + Intronic
1100984050 12:100188214-100188236 TGCGGTGTGGGTTTTGGGAGAGG - Intergenic
1101871078 12:108566078-108566100 TGCTGGTTGGCTTTTCTGAGAGG - Intronic
1103423345 12:120808496-120808518 TACTGTATTGTTTTTCTGAAGGG - Intronic
1103730205 12:123022342-123022364 TGCTCTGTGGGTCTTCCGAGCGG - Intronic
1105705194 13:22963976-22963998 TGCTGTGTGGCCTTTGTGACTGG - Intergenic
1105858110 13:24388992-24389014 TGCTGTGTGGCCTTTGTGACTGG - Intergenic
1106695618 13:32169593-32169615 TGCTGTGTTGTCTCCCTGAGTGG + Intronic
1108847389 13:54694291-54694313 TCCAGTGTGGTTTCTCTAAGGGG + Intergenic
1109698722 13:65996281-65996303 TGCTGTGGGGTTTTCTTGAATGG + Intergenic
1110079072 13:71287692-71287714 TTCAGTTTGGTTTTCCTGAGGGG + Intergenic
1110396186 13:75032179-75032201 TGCTGTTTGGTTTGTCTGTTTGG + Intergenic
1111153869 13:84296455-84296477 TGCTATATGATTTTCCTGAGTGG - Intergenic
1112065349 13:95786999-95787021 TGCTTTTTGGCATTTCTGAGGGG - Exonic
1112233806 13:97616368-97616390 TGCTCTGTGGCATTTCTGACAGG + Intergenic
1113029492 13:105977593-105977615 TGTTGTGTGGATTTTATGTGTGG + Intergenic
1113072439 13:106434572-106434594 TTCTGTGTTTTGTTTCTGAGGGG - Intergenic
1114820112 14:26008340-26008362 TGCTATGTGGATTTTCTGGAGGG - Intergenic
1115735604 14:36325269-36325291 TGCTGGGTTTTTTTTCAGAGTGG - Intergenic
1116552828 14:46264331-46264353 TGCTGTGTCTTTTTTCTCACTGG + Intergenic
1118672401 14:68143599-68143621 TCCTGTGTGGTTTGTGTGTGTGG - Intronic
1118884220 14:69853130-69853152 TGGTGTGTGGTTTTGCTGGTCGG - Intergenic
1119771780 14:77224650-77224672 TGCTGTCTGGAGTTTCTGGGTGG - Intronic
1119782389 14:77285361-77285383 TGCTGTCTGCTTGTTCTTAGTGG - Intronic
1120057220 14:79938642-79938664 TAGTGTGTGGCTTTTCAGAGAGG - Intergenic
1120130012 14:80795561-80795583 TCCTGTGTGATTTTTCTTACAGG - Intronic
1121627614 14:95397941-95397963 TGGTGTGTGTTTTGTCTGTGTGG + Intergenic
1122667110 14:103338205-103338227 TGCTGTGTGGTTTTTCTGAGGGG + Intronic
1122983509 14:105202010-105202032 TTCTGTGTGGTTTTCCTGCCCGG - Intergenic
1123225534 15:17021479-17021501 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1123225555 15:17021821-17021843 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1123226565 15:17041519-17041541 TTCTGTCTGGTTTTTATGTGAGG - Intergenic
1124242061 15:28037065-28037087 TGCTCTGTGGTCTTCCTGAGTGG - Intronic
1124517129 15:30376171-30376193 TGGTGTGTGGTATGTGTGAGTGG + Intronic
1124725815 15:32154827-32154849 TGGTGTGTGGTATGTGTGAGTGG - Intronic
1127295099 15:57602118-57602140 TGCAGGGTGGTTTTGCTAAGAGG + Intronic
1127498969 15:59538446-59538468 TGCTGTTTGTTTTTTTTGCGGGG - Intergenic
1127682992 15:61315729-61315751 TGCTGTGCGGGCTTTCTGAGAGG + Intergenic
1127924778 15:63528553-63528575 TACTGTGTGGTTTTATTGTGTGG + Intronic
1129944623 15:79528023-79528045 TGCTGTGTGGCTTCTCAGAGAGG - Intergenic
1131255116 15:90856898-90856920 TGCTCTGGGGTTTATCTGTGAGG + Intergenic
1131361318 15:91792984-91793006 TGCTGGGTTGTTTTAATGAGAGG + Intergenic
1132182035 15:99762686-99762708 TGCAGTTTGGCTTTTCTGATTGG + Intergenic
1133071827 16:3251694-3251716 TGCTGTGAGGTTATTGTGAGAGG + Intronic
1133582418 16:7158729-7158751 TGGTGTGTGTTGTTTCTGGGTGG + Intronic
1135157549 16:20066057-20066079 TTCTCTGCGGTTTTTCTGAAAGG - Intronic
1135290304 16:21230870-21230892 AGCTTTGTACTTTTTCTGAGTGG + Intergenic
1136653494 16:31693850-31693872 TGGTGTGTGGTTTGTGTGGGGGG - Intergenic
1136906775 16:34099885-34099907 TTCTGTTTAGTTTTTATGAGAGG + Intergenic
1138043090 16:53695529-53695551 TGCTGTGCCTATTTTCTGAGGGG - Intronic
1139303022 16:65961553-65961575 TTCTGTTTGGTCTTTCTGAGGGG - Intergenic
1140181441 16:72722990-72723012 TGCTTTGTGTTTTTGCTTAGTGG + Intergenic
1140621852 16:76744039-76744061 TTTTGTTTTGTTTTTCTGAGAGG + Intergenic
1140622278 16:76749683-76749705 TTTTGTTTTGTTTTTCTGAGAGG + Intergenic
1141810205 16:86371049-86371071 TGCTGTTTTGTTTTCCTGGGGGG - Intergenic
1142196045 16:88739769-88739791 TGCTGTGTGGTCTCTGAGAGGGG - Intronic
1142723474 17:1793823-1793845 TGCAGTGTTTTTTTTTTGAGAGG + Intronic
1142742485 17:1939424-1939446 AGCTGTGTGGATGTCCTGAGAGG + Intronic
1143689316 17:8547490-8547512 TTCTGTGTGGCTCTTCTAAGGGG - Intronic
1144635071 17:16900968-16900990 TGCTGTGTGTATTTTCTTATTGG + Intergenic
1144954939 17:19014403-19014425 GGCTCTGTGGTTTTCCAGAGTGG - Intronic
1145688874 17:26711353-26711375 TGCTGTGTAGTTTTTATGTGAGG - Intergenic
1145819992 17:27824884-27824906 TGCTGTGTGTTTGTTCTGCCAGG - Intronic
1146257578 17:31400525-31400547 TGCTGTGTGGCTCCTCGGAGAGG + Intronic
1146374663 17:32285962-32285984 TGCTGTGGGGTTTTTAGGAGTGG + Intronic
1146967850 17:37048057-37048079 TGCTTTGTGGTTTTTTTATGGGG + Intronic
1148234688 17:45960793-45960815 TGCTTTGTGGGTTTTCTTTGGGG - Intronic
1148678044 17:49456423-49456445 TGGTTTGTGGTTTTTCTGAGTGG + Intronic
1150311852 17:64135413-64135435 TTCTGTGTGGTTTATTTGGGGGG + Intergenic
1150651781 17:67015182-67015204 TGCTCCGTGTTATTTCTGAGCGG - Intronic
1150735540 17:67733939-67733961 TGCTCTGTAGTTTTTTTGTGTGG + Intronic
1153810484 18:8747842-8747864 TGCATTGTGTTTTTCCTGAGTGG + Intronic
1154085911 18:11305516-11305538 TGCTGTGTGGTTGTTGCCAGGGG + Intergenic
1154164285 18:12002836-12002858 TGCAGTGGGGTTTTTCATAGCGG - Intronic
1154518787 18:15203452-15203474 TGTTGTGTGATGTTTCTGTGGGG + Intergenic
1156322745 18:36042859-36042881 TGCCAAGTCGTTTTTCTGAGAGG - Intronic
1158564390 18:58542506-58542528 TACTGTGTGGTTTCTATGATTGG - Intronic
1160175036 18:76586439-76586461 TACAGTTTTGTTTTTCTGAGGGG + Intergenic
1161495878 19:4585252-4585274 TGCTGTGTGGTTTTTGGAAAGGG - Intergenic
1161619168 19:5289414-5289436 TGCTTTCTGGTTTCTGTGAGTGG - Intronic
1162928736 19:13944777-13944799 TGTTTTGGGGTTTTTTTGAGAGG + Intronic
1164352624 19:27370995-27371017 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
1164354039 19:27395011-27395033 TTCTGTGTTGTTTTTATGTGAGG + Intergenic
1164463936 19:28471535-28471557 TGCTGTGAAGTTTGGCTGAGTGG + Intergenic
1164809470 19:31144853-31144875 TGCTGTATGGTTTTCCTGTGTGG + Intergenic
1164926027 19:32130645-32130667 TGCTGTGGGGTTTATGTGAGGGG - Intergenic
1165521227 19:36315823-36315845 TGCTGTGTGCGTGTTCTGAAGGG - Intergenic
1165622838 19:37262767-37262789 TGCTGTGTGCGTGTTCTGAAGGG + Intergenic
1165634529 19:37329400-37329422 TGCTGTGTGCGTGTTCTGAAGGG + Intronic
1166302383 19:41918847-41918869 TGGTGTGTGGTGTGTCTGATGGG - Intronic
926372573 2:12194894-12194916 TGCTTTGTGGTGTTCCTAAGTGG + Intergenic
928540386 2:32278477-32278499 TGGTGGCTGGTTTTTCTGGGTGG + Intronic
928540583 2:32280040-32280062 TGGTGGCTGGTTTTTCTGGGTGG + Intronic
930611315 2:53547194-53547216 TTATGTGTGGTTTTACAGAGGGG + Intronic
931185320 2:59945377-59945399 TGCTGTGCTGTTTTGTTGAGGGG + Intergenic
932345156 2:70990600-70990622 TGCTGTGAGGTGTGTGTGAGGGG - Intronic
932645063 2:73491588-73491610 GGCCGTGTGATTTCTCTGAGTGG + Intronic
933648305 2:84829961-84829983 TGGTGTGTGGTGTGTGTGAGGGG - Intronic
933829017 2:86191540-86191562 TGCTGTGTGGTTTGGCAGACTGG - Intronic
934334138 2:92108011-92108033 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
934334467 2:92112779-92112801 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
934470312 2:94522323-94522345 TTCTGTCTGGTTTTTATGTGAGG + Intergenic
935309773 2:101772055-101772077 TGCTGTGTGATTGTTCTGCCAGG + Intronic
936990455 2:118359201-118359223 TGCAGTGTTTTTATTCTGAGAGG + Intergenic
937553873 2:123130557-123130579 TGCTGTCTGATTTTCCTGAATGG + Intergenic
938256193 2:129861756-129861778 CGCTGTGTGGTGGGTCTGAGGGG - Intergenic
939036774 2:137141344-137141366 TGCTGTCTATTTTTTCTGATTGG - Intronic
940252709 2:151697238-151697260 TGCTTTGTAGTTTTTCTATGAGG + Exonic
941194909 2:162437348-162437370 TACTGAGTTGTTTTTCAGAGTGG + Intronic
942499251 2:176570939-176570961 TTCAGTGTGGTTTTTCTGTAAGG + Intergenic
942712300 2:178850602-178850624 TGCTGTGTGGATCTTCAGGGAGG - Intronic
943881930 2:193156683-193156705 TGCTCTGTGGTTTGATTGAGGGG + Intergenic
944850627 2:203715548-203715570 TGCTGTGTGGTGTCTCTGAGTGG + Intronic
944875535 2:203960912-203960934 GGCTGTGTGGTTTTTATGAGAGG - Exonic
946788434 2:223273576-223273598 TGATGTGGGGTTCTTCTAAGGGG - Intergenic
947393386 2:229663019-229663041 CCCAGTGTGGTTTTTCTTAGAGG - Intronic
948003150 2:234584697-234584719 TGCTATGTGTTTTAACTGAGAGG - Intergenic
1168893603 20:1309350-1309372 TACTGGGTGGTTTCTCTAAGGGG + Intergenic
1171593590 20:26640822-26640844 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171597491 20:26699086-26699108 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171600724 20:26747685-26747707 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171601363 20:26757204-26757226 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171603628 20:26791190-26791212 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171605080 20:26812942-26812964 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171606641 20:26836404-26836426 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171615110 20:26963546-26963568 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171618079 20:27007907-27007929 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171621933 20:27065875-27065897 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171625491 20:27119422-27119444 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171625848 20:27124691-27124713 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171633025 20:27232279-27232301 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171633389 20:27237718-27237740 TTCTGTATAGTTTTTCTGGGAGG - Intergenic
1171633755 20:27243156-27243178 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171636145 20:27278681-27278703 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171637132 20:27293475-27293497 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171637764 20:27303117-27303139 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171638310 20:27311275-27311297 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171640000 20:27336432-27336454 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171640172 20:27338981-27339003 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171642518 20:27374165-27374187 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171643974 20:27395919-27395941 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171651291 20:27505281-27505303 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171651488 20:27508343-27508365 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171651828 20:27513439-27513461 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171652189 20:27518951-27518973 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171655710 20:27571990-27572012 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171656810 20:27588642-27588664 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171657607 20:27600541-27600563 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171665864 20:27724435-27724457 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171667557 20:27749756-27749778 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171668458 20:27763178-27763200 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171669628 20:27780852-27780874 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171669922 20:27785275-27785297 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171671119 20:27803117-27803139 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171671301 20:27805836-27805858 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171673537 20:27839318-27839340 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171674838 20:27858868-27858890 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171677679 20:27901591-27901613 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171680104 20:27937969-27937991 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171680274 20:27940519-27940541 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171682461 20:27973143-27973165 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
1171684166 20:27998639-27998661 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171684350 20:28001359-28001381 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171684746 20:28007478-28007500 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171688713 20:28066950-28066972 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171689062 20:28072046-28072068 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171689902 20:28084798-28084820 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171690681 20:28096353-28096375 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171692478 20:28123213-28123235 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171694337 20:28150747-28150769 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171702661 20:28276395-28276417 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171703606 20:28290676-28290698 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171704113 20:28298319-28298341 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171705507 20:28319524-28319546 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171711116 20:28403972-28403994 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171711529 20:28410085-28410107 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171712097 20:28418764-28418786 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
1171713091 20:28433547-28433569 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171714642 20:28456800-28456822 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171715829 20:28474638-28474660 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171716675 20:28487383-28487405 TTCTGTCTAGTTTTTCTGGGAGG - Intergenic
1171735955 20:28784876-28784898 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
1171738959 20:28836306-28836328 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1171739730 20:28866424-28866446 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1171741845 20:28904401-28904423 TTCTGTCTAGTTTTTCTGTGAGG - Intergenic
1171757990 20:29133701-29133723 TGCTGTGTAGTTTTTATTTGAGG - Intergenic
1171758462 20:29142467-29142489 TGCTGTGTAGTTTTTATTTGAGG - Intergenic
1171761686 20:29206566-29206588 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1171826223 20:29910369-29910391 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171826289 20:29911736-29911758 TGCTGTCTTGTTTTTATGTGCGG - Intergenic
1171826355 20:29912932-29912954 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171826423 20:29914300-29914322 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171826480 20:29915496-29915518 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171826551 20:29916864-29916886 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171826629 20:29918578-29918600 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171826744 20:29920798-29920820 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171826812 20:29922169-29922191 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171826928 20:29924391-29924413 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827066 20:29927124-29927146 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827128 20:29928493-29928515 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827194 20:29929858-29929880 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827264 20:29931223-29931245 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827334 20:29932592-29932614 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827406 20:29933961-29933983 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827473 20:29935327-29935349 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827588 20:29937553-29937575 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171827659 20:29938920-29938942 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827726 20:29940287-29940309 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827791 20:29941656-29941678 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171827863 20:29943023-29943045 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171827950 20:29944730-29944752 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828017 20:29946099-29946121 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828087 20:29947468-29947490 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828160 20:29948836-29948858 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171828227 20:29950203-29950225 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828299 20:29951570-29951592 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828397 20:29953448-29953470 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828469 20:29954816-29954838 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828607 20:29957550-29957572 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828679 20:29958917-29958939 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171828980 20:29964732-29964754 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829048 20:29966101-29966123 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829191 20:29968836-29968858 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829262 20:29970204-29970226 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829334 20:29971570-29971592 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829485 20:29974306-29974328 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829554 20:29975674-29975696 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829624 20:29977042-29977064 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171829737 20:29978849-29978871 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829807 20:29980217-29980239 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829878 20:29981585-29981607 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171829946 20:29982949-29982971 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171830130 20:29986538-29986560 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171830202 20:29987904-29987926 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171830275 20:29989271-29989293 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171830414 20:29992004-29992026 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171830555 20:29994737-29994759 TGCTGTCTAGTTTTTATGTGTGG - Intergenic
1171830701 20:29997479-29997501 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171830768 20:29998847-29998869 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171830842 20:30000214-30000236 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171830912 20:30001581-30001603 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171830983 20:30002949-30002971 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171831133 20:30005681-30005703 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831208 20:30007049-30007071 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831350 20:30009784-30009806 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831420 20:30011152-30011174 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171831492 20:30012518-30012540 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831566 20:30013887-30013909 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831633 20:30015253-30015275 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831702 20:30016620-30016642 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831769 20:30018108-30018130 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171831837 20:30019478-30019500 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171831928 20:30021356-30021378 TGCTGTCTAGTTTTTATGGGCGG - Intergenic
1171832002 20:30022724-30022746 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832139 20:30025460-30025482 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832209 20:30026828-30026850 TGCTGTCTTGTTTTTATGTGCGG - Intergenic
1171832272 20:30028195-30028217 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832343 20:30029563-30029585 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832419 20:30031157-30031179 TGCTGTCTTGTTTTTATGTGCGG - Intergenic
1171832491 20:30032523-30032545 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832562 20:30033891-30033913 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832678 20:30036106-30036128 TGCTGTCTAGTTTTTATGTGTGG - Intergenic
1171832748 20:30037471-30037493 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832855 20:30089494-30089516 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832891 20:30090179-30090201 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171832954 20:30091378-30091400 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833043 20:30093087-30093109 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833145 20:30094973-30094995 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833211 20:30096225-30096247 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833283 20:30097592-30097614 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833377 20:30099398-30099420 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833447 20:30100765-30100787 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833600 20:30103730-30103752 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833669 20:30105097-30105119 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833702 20:30105771-30105793 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833774 20:30107138-30107160 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833846 20:30108505-30108527 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833904 20:30109563-30109585 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171833972 20:30110930-30110952 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834031 20:30112090-30112112 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834130 20:30114139-30114161 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834203 20:30115506-30115528 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834252 20:30116541-30116563 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834320 20:30117908-30117930 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834390 20:30119275-30119297 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834524 20:30121802-30121824 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171834665 20:30124535-30124557 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171835077 20:30132105-30132127 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171835148 20:30133471-30133493 TGCTGTCTAGTTTTTATGTGAGG - Intergenic
1171835218 20:30134837-30134859 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171835296 20:30136366-30136388 TGCTGTCTAGTTTTTATGTGCGG - Intergenic
1171864690 20:30476655-30476677 TTCTGTCTAGTTTTTCTGTGAGG + Intergenic
1171909331 20:30928935-30928957 TTCTGTCTGGTTTTTCTGTGAGG - Intergenic
1172950266 20:38719073-38719095 TGTTGTGTGTTTCTTCAGAGGGG + Intergenic
1173148106 20:40542932-40542954 TGCTAAGTGGATATTCTGAGAGG - Intergenic
1173149387 20:40553008-40553030 TGCTGTGTGCTTTGTGTGTGTGG - Intergenic
1173380761 20:42538565-42538587 TGATGTGTAATATTTCTGAGCGG - Intronic
1173611571 20:44372016-44372038 TGCTGTATTGTTTTTCTTAGAGG + Intronic
1176323324 21:5356482-5356504 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1176323343 21:5356824-5356846 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1176323935 21:5367924-5367946 TTCTGTCTGGTTTTTATGTGAGG - Intergenic
1176480977 21:7288102-7288124 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1176480996 21:7288444-7288466 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1176481694 21:7301931-7301953 TTCTGTCTGGTTTTTATGTGAGG - Intergenic
1176482987 21:7325171-7325193 TACTGTGTTGTTTTTATGTGAGG + Intergenic
1176795494 21:13368529-13368551 TGCTGTTTGGCTCTTCTGGGTGG + Intergenic
1177857726 21:26418597-26418619 TGCTGGTTGGATTTTCTGAGAGG + Intergenic
1179930071 21:44562912-44562934 TGCTGTTTTGTTTTTCTGTGTGG - Intronic
1179955204 21:44734632-44734654 TGCTGTGTGGAATGACTGAGGGG - Intergenic
1180310307 22:11219804-11219826 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1180399505 22:12397042-12397064 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1180399919 22:12405547-12405569 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1180400423 22:12414776-12414798 TTCTGTCTGGTTTTTATGTGAGG - Intergenic
1180503526 22:15964854-15964876 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
1180673002 22:17567979-17568001 TGCTGTCTGGTTTTTTTGGCTGG + Intronic
1180879157 22:19191754-19191776 TGTTGTTTGGTTTTGCTGTGGGG - Intronic
1181878257 22:25956932-25956954 GGCTGTCTGGTTCTTCTGTGAGG + Intronic
1184284749 22:43464211-43464233 CACTGTGGGGTTTTTCTCAGAGG + Intronic
1185123112 22:48985430-48985452 TGCTGTGTGGTGTATGTGTGTGG + Intergenic
1185281868 22:49973761-49973783 TGGTGTGTGGTGTTTGTGTGTGG + Intergenic
1203335049 22_KI270739v1_random:57658-57680 TTCTGTCTAGTTTTTATGAGAGG + Intergenic
1202715974 2_KI270715v1_random:2366-2388 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
1202716303 2_KI270715v1_random:7134-7156 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
1202716681 2_KI270715v1_random:12586-12608 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
1202728667 2_KI270716v1_random:36325-36347 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
1202728996 2_KI270716v1_random:41093-41115 TTCTGTCTAGTTTTTATGAGAGG - Intergenic
950894371 3:16434641-16434663 TTCTGTGTGTTTTTTTTTAGAGG - Intronic
955775846 3:62432101-62432123 TGCAGTGTAGTTTTGTTGAGGGG + Intronic
957737642 3:84223947-84223969 TGCTGTGTGAGTTTTGTGAAGGG + Intergenic
958201671 3:90326426-90326448 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
958205058 3:90380741-90380763 TTCTGTCTGGTTTTTATGTGAGG + Intergenic
958221142 3:90681825-90681847 TTCTGTCTAGTTTTTCTAAGAGG + Intergenic
962485134 3:135835103-135835125 TGCTGAGATTTTTTTCTGAGTGG - Intergenic
962490096 3:135884905-135884927 TGTTGTGGGGTTTTTGTAAGTGG - Intergenic
962666072 3:137654667-137654689 TGCTGTCTTTTTTTTCAGAGAGG - Intergenic
963830513 3:150003299-150003321 TGCAGTGAGGTGTTTGTGAGAGG - Intronic
964243069 3:154618608-154618630 AGCTGTGTGGTTTTCCGTAGTGG - Intergenic
964663639 3:159149477-159149499 TGCTCTTTGGTAGTTCTGAGTGG + Intronic
964807822 3:160630958-160630980 TGCTGTGTTCTGTTTCTGGGTGG + Intergenic
967638899 3:191837401-191837423 TGTTGTGTGTTTTTTCTCATTGG - Intergenic
968664612 4:1814336-1814358 TGCTTTGTGGTGATTCTCAGTGG - Exonic
968936071 4:3611223-3611245 TGTTGTGTGGTTTGTGTGAGTGG + Intergenic
969900319 4:10343255-10343277 TTCTGAGTTGTTTTTCTTAGGGG + Intergenic
969910184 4:10437433-10437455 TGCTGTGTGTTGTTTCTCACCGG + Intergenic
970722123 4:18999861-18999883 TGCAGCGTGGTTATTCTGAAAGG - Intergenic
971014722 4:22476120-22476142 TCCTTTGTGGTTTTGATGAGAGG - Intronic
973404877 4:49719011-49719033 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973406065 4:49738243-49738265 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973406146 4:49739603-49739625 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973409322 4:49791650-49791672 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973412569 4:49845386-49845408 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973415153 4:49887891-49887913 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973415501 4:49893668-49893690 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973418743 4:49947206-49947228 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973418813 4:49948391-49948413 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973418958 4:49950937-49950959 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973420648 4:49978647-49978669 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973420797 4:49981194-49981216 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973422040 4:50001599-50001621 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973422689 4:50012479-50012501 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973423942 4:50033054-50033076 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973424252 4:50038149-50038171 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973425087 4:50052089-50052111 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973426683 4:50078451-50078473 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973427847 4:50097842-50097864 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973428873 4:50114680-50114702 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973429951 4:50132697-50132719 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973431203 4:50153280-50153302 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973431543 4:50159056-50159078 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973431694 4:50161604-50161626 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973432831 4:50180315-50180337 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973432914 4:50181674-50181696 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973433356 4:50189329-50189351 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973434055 4:50200890-50200912 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973435129 4:50218911-50218933 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973436839 4:50246635-50246657 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973437193 4:50252423-50252445 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973438082 4:50267211-50267233 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973438231 4:50269758-50269780 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973442716 4:50343722-50343744 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973444637 4:50375347-50375369 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973444786 4:50377895-50377917 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973445613 4:50391842-50391864 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973447184 4:50418186-50418208 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973447828 4:50428896-50428918 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973447979 4:50431443-50431465 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973450703 4:50476154-50476176 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973450856 4:50478702-50478724 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973451243 4:50485162-50485184 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973455111 4:50549598-50549620 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973457758 4:50592794-50592816 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973460286 4:50634133-50634155 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973460437 4:50636681-50636703 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973460934 4:50644846-50644868 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973466010 4:50728338-50728360 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973468490 4:50769289-50769311 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973471873 4:50825061-50825083 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973473603 4:50853453-50853475 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973475077 4:50877915-50877937 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973478020 4:50926879-50926901 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973479823 4:50956465-50956487 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973480206 4:50962928-50962950 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973481954 4:50991836-50991858 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973483559 4:51018531-51018553 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973484070 4:51027030-51027052 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973488252 4:51095912-51095934 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973490196 4:51128066-51128088 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973492372 4:51163604-51163626 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973496217 4:51227387-51227409 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973496378 4:51229940-51229962 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973500351 4:51295578-51295600 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973502610 4:51332822-51332844 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973504361 4:51361729-51361751 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973508005 4:51421584-51421606 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973509194 4:51440816-51440838 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973509341 4:51443371-51443393 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973511168 4:51473478-51473500 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973511632 4:51481303-51481325 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973512771 4:51500014-51500036 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973513977 4:51519570-51519592 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973519091 4:51603760-51603782 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973519772 4:51614820-51614842 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973523521 4:51676413-51676435 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973524465 4:51691881-51691903 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973526066 4:51717900-51717922 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973526337 4:51722325-51722347 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973527131 4:51735252-51735274 TTCTTTCTGGTTTTTATGAGAGG - Intergenic
973812049 4:54581081-54581103 TGCTGGGTGGCTTTTTTAAGTGG + Intergenic
975216761 4:71764443-71764465 TTCTATGTGGTTTGTGTGAGAGG + Intronic
975301816 4:72798991-72799013 TGCTGTGTCGTTGTTCTCATTGG + Intergenic
975398255 4:73903083-73903105 GGCAGTGTGATTTTTCAGAGGGG - Intergenic
976536110 4:86219361-86219383 TTCTGTTTGGTTTTTCTAATTGG + Intronic
977180388 4:93866590-93866612 TGGTGTGTGGTTTTTTTTGGAGG + Intergenic
977744402 4:100528419-100528441 TGCTGTGTCGTTGTTCTCATTGG + Intronic
979929484 4:126612661-126612683 TGATGTTTGTTATTTCTGAGAGG - Intergenic
981741141 4:148003108-148003130 TGCTGTGTCGTTGTTCTCATTGG + Intronic
982425081 4:155248612-155248634 TTCTGTGTGCCCTTTCTGAGTGG - Intergenic
982465788 4:155729968-155729990 TGTTGTGTTCTTTTTTTGAGTGG + Intronic
982538624 4:156639393-156639415 TGCTGTGTAGTTTTTGAAAGTGG + Intronic
984593891 4:181645610-181645632 TGCAGTGTGGTTTTTTTGAGAGG - Intergenic
984649792 4:182258525-182258547 TGCTGTATTTTTTTTTTGAGAGG - Intronic
986516133 5:8565729-8565751 TGCTGGGTGGTATTACTCAGAGG + Intergenic
987184218 5:15398786-15398808 TGTTGTGTGTTTTTTCTCATTGG - Intergenic
987550645 5:19375870-19375892 TCCTGTGTATTTTTTGTGAGTGG + Intergenic
988186480 5:27870838-27870860 TGCTGTTTGATTCTTCTCAGTGG - Intergenic
988652524 5:33167760-33167782 TGCTGTGCTGTCTGTCTGAGTGG + Intergenic
989857923 5:46322125-46322147 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
989864181 5:46426085-46426107 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
989943744 5:50190418-50190440 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
989945752 5:50226396-50226418 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
990730789 5:58806859-58806881 AGCTGTCTGGTTTATTTGAGTGG - Intronic
990809643 5:59708280-59708302 AGCTGTGGGGTTTGTTTGAGAGG - Intronic
993258903 5:85632380-85632402 TCCTGTCTGGTTTTTCTGAGTGG + Intergenic
995577298 5:113552442-113552464 TGATATGTGGTTTTTGTGATTGG + Intronic
995972416 5:117988703-117988725 TACTGTGTGGTTTTTGAGTGTGG - Intergenic
996578983 5:125008826-125008848 TGATAAGAGGTTTTTCTGAGAGG + Intergenic
996685459 5:126275309-126275331 TGCTGTGTGTTTTTTTTTGGCGG - Intergenic
998043946 5:138971448-138971470 TGCTGTGTAGATTTCCTAAGTGG - Intronic
1001273245 5:170331623-170331645 TGGTGTGAGGTCTTTCAGAGGGG + Intergenic
1003452289 6:6245999-6246021 AGCTGTGTGTGTTTTCTCAGGGG - Intronic
1003706706 6:8539760-8539782 TGCTTTGTGATTTTTTTGGGAGG - Intergenic
1004317325 6:14601173-14601195 GCCTGTTTGGCTTTTCTGAGGGG - Intergenic
1004717422 6:18231166-18231188 TGTTGTGTCGTTTTTCTCATTGG - Intronic
1007268405 6:40615961-40615983 TGATTTGTTGTTTTTCTAAGTGG + Intergenic
1008306827 6:49913602-49913624 TGCTGTGTGGTTTTAGTATGGGG - Intergenic
1008489946 6:52076188-52076210 AGGTGAGTGGTTTTTATGAGTGG - Intronic
1009529151 6:64787785-64787807 TTCTGTGTGGCTTTTCTTTGGGG + Intronic
1009698573 6:67143293-67143315 TGCTTTTTTGTTTTTCTGAAAGG - Intergenic
1010219031 6:73431466-73431488 TGTTGTTTTGTTTTTTTGAGAGG - Intronic
1010272281 6:73928124-73928146 TTCTGTGTGGTATTTCACAGGGG - Intergenic
1010345862 6:74810064-74810086 TGCTTTTTGCTTTTTCTGAGTGG + Intergenic
1010959941 6:82134419-82134441 TGCTATGTGTTTTTTGAGAGTGG - Intergenic
1013093110 6:106919305-106919327 TGCTGTGCTCTTTTTCTGACAGG - Intergenic
1014511893 6:122332694-122332716 TGCTGGCTGGGTTTTGTGAGGGG + Intergenic
1014986239 6:128013802-128013824 TGCTGTGTGATCTGCCTGAGAGG - Intronic
1015407133 6:132850633-132850655 TGCTTTGTGGTCTTTTTGAAAGG + Intergenic
1016075694 6:139793144-139793166 GGCAGTGTTGTTTTTGTGAGAGG + Intergenic
1016393400 6:143597577-143597599 TGCTGTCTGTTTTTCCTGATGGG + Intronic
1018689295 6:166331857-166331879 TGCTGTGAGGATTTAGTGAGAGG + Intronic
1020244634 7:6421131-6421153 CTCTGTGTGTGTTTTCTGAGAGG - Intronic
1020664822 7:11026628-11026650 AGCTGTGTTGTTTTTCTGTATGG + Intronic
1020852076 7:13366965-13366987 TTCTTTGTGGATTTTCTGAATGG + Intergenic
1020901731 7:14011865-14011887 TCATGTGTGTTCTTTCTGAGGGG - Intergenic
1021470988 7:21002425-21002447 TGCTGTTTGGTTCTTCTTTGTGG - Intergenic
1023978217 7:45048883-45048905 TGCTGTGTGGTTTTAATAATGGG + Intronic
1024133243 7:46378661-46378683 TGTTGTGTTTTTGTTCTGAGGGG - Intergenic
1024308293 7:47946394-47946416 TGCTGTGTGGTGTGTTTGTGTGG - Intronic
1025023877 7:55500161-55500183 TGCAGGGTGGGTTCTCTGAGGGG - Intronic
1025570973 7:62566240-62566262 TTCTGTGTAGTTTTTATGAGAGG + Intergenic
1026090568 7:67296884-67296906 TTCTGAGAGGTTTTTCTAAGGGG + Intergenic
1026180200 7:68032501-68032523 AGCAGTGTGGTTATCCTGAGTGG - Intergenic
1027120164 7:75512256-75512278 TTCTGAGAGGTTTTTCTAAGGGG + Intergenic
1027474986 7:78618426-78618448 CTCTGTGTTGTTTTTCTGAGTGG - Intronic
1027636032 7:80675800-80675822 TAATGTGTGGTTTTACTCAGGGG + Intronic
1030965222 7:115984306-115984328 TGGTGAGTGGGTTTTCTGTGAGG + Exonic
1031133914 7:117865241-117865263 TGCTGTGATTTTTTTCTGGGGGG - Intronic
1033648395 7:143322018-143322040 AGCTGTGTGGTTTTTGTCATTGG - Intronic
1033779979 7:144657454-144657476 TTTTGTGTGGCTTTTCTAAGTGG - Intronic
1033801861 7:144911218-144911240 TGCTTTGAGATTTTTCTGACAGG + Intergenic
1034795643 7:154010234-154010256 TGCTGTGTTCTGTTTCTGAAAGG - Intronic
1035062487 7:156079814-156079836 TGTTCTGTGGTTTTCCTGGGGGG - Intergenic
1035351846 7:158252728-158252750 TGCTGTGTGATTTTGCTGCTTGG - Intronic
1036614218 8:10375931-10375953 TTCTGTGTGGACTTTCTGATGGG + Intronic
1036809981 8:11861245-11861267 TGCTGGGTGGGTTTTCTGACAGG - Intronic
1037588500 8:20294538-20294560 TGCAGTGTGGTTTGTCTGCTGGG + Intronic
1038574225 8:28690443-28690465 AGCTGGGTGTTTTTTCTGGGTGG + Intronic
1039455203 8:37701219-37701241 TGCTGTTTGCTTTTTCTGTAAGG + Intergenic
1041383288 8:57274633-57274655 TGGTGAGTTCTTTTTCTGAGAGG - Intergenic
1043143665 8:76623558-76623580 TTCTGTGTGATTTTTCTATGTGG + Intergenic
1043785585 8:84394854-84394876 GGAAGTGTGGTTTTTCTCAGGGG + Intronic
1044993641 8:97818436-97818458 TGCTGTGTGAGTGTTCTGTGGGG + Intronic
1045748362 8:105451780-105451802 TGCTGTGTCAGTTTGCTGAGTGG - Intronic
1046847233 8:118931263-118931285 TGCTGTGTGGGTTTTTAGGGAGG + Intronic
1049078753 8:140423860-140423882 TGGTATGTGGTTTTTGTGACTGG - Intronic
1049119082 8:140718037-140718059 TGCTGCGTGGGATTTCTCAGAGG - Intronic
1049241756 8:141541076-141541098 TGGTGTGTGGTGTGTCTGTGTGG - Intergenic
1049607321 8:143535800-143535822 TACTGTGTGAGTTTTTTGAGTGG - Intronic
1050081105 9:1916851-1916873 GGCTGTGTGGTTTTGCTGCATGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052115196 9:24641929-24641951 TGCTGTGTCTTTTTTCTCATTGG + Intergenic
1054454216 9:65421219-65421241 TGTTGTGTGGTTTGTGTGAGTGG - Intergenic
1057568875 9:96188617-96188639 TTCTGTGTGGCTGTTCCGAGTGG - Intergenic
1057607008 9:96505990-96506012 TGATTTTTGGTTTTACTGAGAGG - Intronic
1057623864 9:96660520-96660542 GGTTGTGTGGTTTTTTTGACTGG + Intergenic
1058123301 9:101162990-101163012 TGCCTTGTGGTTTCTCTGTGAGG + Intronic
1059380723 9:113921368-113921390 TGATGTCTGGTTTCACTGAGTGG + Intronic
1059456236 9:114402047-114402069 TGCTGTGTGGTTTACCTGGGTGG - Intergenic
1061925346 9:133803472-133803494 AGCCGTGTGGTTTTTCTCTGTGG - Intronic
1061958236 9:133974700-133974722 GAGTGTGTGGATTTTCTGAGTGG - Intronic
1203380737 Un_KI270435v1:36418-36440 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1203381138 Un_KI270435v1:44747-44769 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1203381454 Un_KI270435v1:51064-51086 TTCTGTCTGGTTTTTATGTGAGG - Intergenic
1203383407 Un_KI270435v1:86412-86434 TTCTGTCTAGTTTTTCTGTGAGG + Intergenic
1203355685 Un_KI270442v1:139072-139094 TGCTGTCTAGTTTTTATGTGTGG + Intergenic
1203400118 Un_KI270519v1:80581-80603 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1203400138 Un_KI270519v1:80921-80943 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1203400261 Un_KI270519v1:83313-83335 TTCTGTGTAGTTTTTATGGGAGG - Intergenic
1203400857 Un_KI270519v1:95221-95243 TTCTGTCTGGTTTTTATGTGAGG - Intergenic
1203401649 Un_KI270519v1:108322-108344 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1203402934 Un_KI270519v1:132234-132256 TTCTGTCTAGTTTTTCTGTGAGG + Intergenic
1203406812 Un_KI270538v1:29215-29237 TTCTGTGTGGTTTTTATGTGAGG - Intergenic
1203415968 Un_KI270588v1:3418-3440 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
1203413882 Un_KI270589v1:29684-29706 TTCTGTGTAGTTTTTATGTGAGG + Intergenic
1203684397 Un_KI270757v1:30194-30216 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1186102868 X:6175197-6175219 TGCTGTGCTGTTTTTCTCAGAGG - Intronic
1186556488 X:10565562-10565584 TGGTATGTGTTTTTCCTGAGAGG + Intronic
1186778282 X:12887878-12887900 TGCTGTGTGGTTTGTCTGGTGGG + Exonic
1187322797 X:18255978-18256000 TGCTGTTTGTTTTTTGGGAGTGG - Intronic
1188417463 X:29953746-29953768 TGCTGTGTTGATTTTCTGTTGGG - Intronic
1191566976 X:62551158-62551180 TTCTGTGTAGTTTTTATGTGAGG - Intergenic
1191567119 X:62554217-62554239 TCCTGTGTGGTTTTTACGTGAGG - Intergenic
1191583296 X:62789891-62789913 TTCTTTCTGGTTTTTCTCAGGGG + Intergenic
1191837875 X:65484473-65484495 TGCTGTGTGGGATTTCTGGTGGG - Intronic
1193247248 X:79243755-79243777 TTCAGTTTGGTTTTTCTGTGGGG - Intergenic
1193628490 X:83850337-83850359 AGAAGTGTGGTTTTTCTGGGTGG - Intergenic
1194356610 X:92892931-92892953 GGTTGAGTGGTTTTTCTGATTGG + Intergenic
1196706879 X:118724611-118724633 TGGTGTGAGGTTTTGCTTAGAGG + Intergenic
1196979177 X:121192662-121192684 TGCTGTGTGGTTTTGCTGTAAGG - Intergenic
1197845156 X:130793649-130793671 TTCTCTGTGTTTTTTCTGTGGGG + Intronic
1198150721 X:133906172-133906194 TGCAGTGTTCTTTTTCTAAGTGG + Intronic
1199652789 X:149963496-149963518 TGCTGTGTTATTTCACTGAGAGG + Intergenic
1199860067 X:151793411-151793433 TGCTGTGTGGTTGCTGTTAGTGG - Intergenic
1200664942 Y:6009931-6009953 GGTTGAGTGGTTTTTCTGATTGG + Intergenic
1201079579 Y:10225072-10225094 TTCTGTCTGGTTTTTGTGTGAGG + Intergenic
1201080276 Y:10237475-10237497 TTCTGTGTAGTTTTTCTGTGAGG + Intergenic
1201081586 Y:10256796-10256818 TTCTGTGTGGTTTTTATGTGAGG + Intergenic
1201096150 Y:10618373-10618395 TTCTGTGTGGTTTTTATGTGAGG + Intergenic