ID: 1122678704

View in Genome Browser
Species Human (GRCh38)
Location 14:103439245-103439267
Sequence AAGGGGAATCAGGTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 379}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122678704_1122678711 -3 Left 1122678704 14:103439245-103439267 CCCTCCTCAACCTGATTCCCCTT 0: 1
1: 0
2: 2
3: 29
4: 379
Right 1122678711 14:103439265-103439287 CTTCTTCATTGCCCACCTACTGG 0: 1
1: 0
2: 0
3: 9
4: 148
1122678704_1122678716 13 Left 1122678704 14:103439245-103439267 CCCTCCTCAACCTGATTCCCCTT 0: 1
1: 0
2: 2
3: 29
4: 379
Right 1122678716 14:103439281-103439303 CTACTGGGTAAACACTAACAAGG 0: 1
1: 0
2: 4
3: 11
4: 105
1122678704_1122678712 -2 Left 1122678704 14:103439245-103439267 CCCTCCTCAACCTGATTCCCCTT 0: 1
1: 0
2: 2
3: 29
4: 379
Right 1122678712 14:103439266-103439288 TTCTTCATTGCCCACCTACTGGG 0: 1
1: 0
2: 0
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122678704 Original CRISPR AAGGGGAATCAGGTTGAGGA GGG (reversed) Intronic
901224754 1:7606803-7606825 AAGGATCATCAGGGTGAGGAGGG + Intronic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902550825 1:17218710-17218732 AAGGAGAATGAGTTTGGGGATGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903137078 1:21316562-21316584 AACTGGAATCAGGCCGAGGATGG - Intronic
903292123 1:22320878-22320900 ATGGGGAATGAGGGAGAGGAGGG + Intergenic
903998099 1:27320872-27320894 AAGAGTAATCAGGTAAAGGAAGG - Intergenic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905423490 1:37864237-37864259 ATGAGAAATGAGGTTGAGGAGGG - Intronic
906248754 1:44295234-44295256 AATGTGAATCTGGTTGAAGATGG - Intronic
907830149 1:58057100-58057122 AGGGAGAATCAGGTTGAGTGAGG - Intronic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
908702777 1:66920222-66920244 AAGAGGAATCTGGCTGGGGACGG + Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
909170235 1:72284333-72284355 AAGGGGGATGGGGTGGAGGAAGG - Intergenic
909967627 1:81935510-81935532 AAGGTGAATCATGTTAAAGATGG - Intronic
910946690 1:92600476-92600498 AAGGGGAAACAGGCTGGGGCTGG + Intronic
911244306 1:95499958-95499980 AAAGGGAAGCAGGTTTAAGAGGG - Intergenic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
915975213 1:160381546-160381568 AAGGAGAATAAGGTTAGGGATGG - Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916826615 1:168448018-168448040 AAGGGGATTAAGGTTGCAGATGG - Intergenic
917405352 1:174700421-174700443 AAGGGTAAAATGGTTGAGGAAGG + Intronic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
919010947 1:191962508-191962530 AAGTGAAATTAGGTTGAGGGGGG - Intergenic
919570458 1:199242487-199242509 AAGGGGAACCACGTTCAGAAAGG + Intergenic
920077703 1:203349260-203349282 AAGGGAAAGCAGCTTGAGGTAGG + Intronic
920855754 1:209660042-209660064 AAGGGCATTCAGGTCAAGGAGGG - Intergenic
920865138 1:209745820-209745842 AAGGGGAATTTGGTAGAAGACGG - Intergenic
922357662 1:224791779-224791801 AAGGGAAGTAAGCTTGAGGAGGG - Intergenic
922572018 1:226639927-226639949 AAGGGCATCCAGGCTGAGGATGG + Intronic
922822395 1:228493451-228493473 AAGGGGTTTTAAGTTGAGGAGGG + Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922994517 1:229945189-229945211 ATGGGGAATTGGGGTGAGGAGGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
924081477 1:240403145-240403167 AAAGGAAATCAGGGTGAGAAAGG + Intronic
924644723 1:245867055-245867077 AAGGGGAATTAAGTTGTAGATGG + Intronic
1063157273 10:3391248-3391270 AAGGGGTATCTGGGTGAGAAAGG + Intergenic
1063259117 10:4364489-4364511 AAATGGAACCAGGTTGAGAAAGG + Intergenic
1063901505 10:10737619-10737641 AAGGGGATTCAGGCAGAGGATGG - Intergenic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1067226029 10:44376283-44376305 AGTGGGAATCAGGTTCAGGTTGG - Intronic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068199188 10:53761050-53761072 AAGAGGAAGCAGGTTGGGGTGGG + Intergenic
1068564192 10:58553205-58553227 AAGGGGAATTAGGTTGCAGATGG + Intronic
1068936351 10:62639052-62639074 GAGAGGATCCAGGTTGAGGAGGG + Intronic
1069021888 10:63498202-63498224 AAGGGCAGTAAGTTTGAGGATGG + Intergenic
1069441539 10:68433148-68433170 AAGGAGCATCAGGTTCAGCAGGG - Intronic
1070042894 10:72799218-72799240 AAAAAGAATCAGGTTGAGGCCGG - Intronic
1070328807 10:75403982-75404004 GAGGGGAGTCAGGTGGGGGAGGG - Intergenic
1072338367 10:94421162-94421184 AGGGGGAACCAGGTGGAGGTGGG - Intronic
1072519127 10:96214674-96214696 AAGGGAAGTCAGGTTGGGGTTGG + Intronic
1072529520 10:96305872-96305894 AAGAGAAATCAGGTGGAAGAAGG - Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1074367625 10:112872170-112872192 CACAGGAATCAGGTTGATGAAGG - Intergenic
1074517694 10:114186238-114186260 CAGGGGAATCAGGTGGTGGTTGG - Intronic
1075086097 10:119415386-119415408 AAGGGGAAGCAGGTCGGGCAGGG + Intronic
1077506370 11:2931635-2931657 AAGAGGAAACTGGTTCAGGATGG + Intergenic
1078179504 11:8999126-8999148 AGCGGGGAGCAGGTTGAGGATGG - Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079260768 11:18878106-18878128 AAGAGAAATCAGATTGTGGATGG + Intergenic
1082123598 11:48406459-48406481 AAGGGCAATCAGGCAGGGGAAGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083143156 11:60738197-60738219 AAAGGGAAGCAGCTTGAGTAGGG + Intronic
1083372669 11:62194193-62194215 AAGGGAGAGCAGGTTGAGGGCGG - Intergenic
1084931091 11:72556537-72556559 AATGGGAATCATGTTCACGACGG - Intergenic
1085721883 11:78919640-78919662 AAAGGGAAACAGGGTCAGGAGGG + Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086825414 11:91489799-91489821 AAGGACCATCAGGTTGAGGCAGG + Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1089063752 11:115646395-115646417 CAGGGGTGTCTGGTTGAGGAGGG + Intergenic
1089448595 11:118573415-118573437 AAGGTTAATGTGGTTGAGGATGG + Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089915532 11:122152098-122152120 AAGGGGGCTGAGGTGGAGGAAGG - Intergenic
1089994118 11:122888676-122888698 AAGGGGAATGAGTTTGAGAAGGG - Intronic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091303894 11:134524381-134524403 ATGGGGAACAAGGTTCAGGAGGG - Intergenic
1091592017 12:1848206-1848228 AAAGGGAATCAGGTTAAAGGAGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093517965 12:20013368-20013390 ATGGGGACTGAGGTTGAGGAGGG - Intergenic
1095116112 12:38354175-38354197 CAGGGGAATCAGGTAGGAGAAGG - Intergenic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096290537 12:50338781-50338803 AATGGGAATCAGGTTCAGAAAGG - Intronic
1096327341 12:50676149-50676171 AAGGGGAATGAGTGTGAGTATGG + Intronic
1096410839 12:51376180-51376202 AAGAGGAAACAGGTTCAGGGAGG + Intronic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097263280 12:57731653-57731675 TATTGGAATCAGTTTGAGGATGG + Intronic
1097333077 12:58353408-58353430 AAAGGGAATCAGTTTTAAGAGGG - Intergenic
1097981780 12:65742645-65742667 AAGGGAAATCCGGATAAGGATGG + Intergenic
1098311257 12:69151403-69151425 AAGAGGAAACGGGTTGAAGAGGG + Intergenic
1098957850 12:76705979-76706001 TAGGGGAATAAGCTTGATGAGGG - Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1101290392 12:103361889-103361911 AAGGACCATCAGGTTGGGGAAGG - Intronic
1101598678 12:106189621-106189643 TAGGGAAATCAAGTAGAGGAAGG + Intergenic
1102204902 12:111083593-111083615 AAGAGGACTGAGGTTTAGGAGGG + Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1105799605 13:23891899-23891921 AAGGGGAATAAGGGTGACGTGGG - Exonic
1105849442 13:24321136-24321158 AAGGGGAATAAGGGTGACGTGGG + Exonic
1106250946 13:27981084-27981106 GTGAGGAATCAGGTAGAGGATGG + Intronic
1108709194 13:53016379-53016401 AAGGGGAATTAAGTTGCAGATGG + Intergenic
1108714938 13:53069590-53069612 AAGTGGACTCAGGTTCAAGAAGG + Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1115286022 14:31713214-31713236 AAGGGCACTCAAGTTGAGAAAGG - Intronic
1116043763 14:39717651-39717673 TAGGGGGATGAGTTTGAGGAGGG + Intergenic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1118592766 14:67413506-67413528 AAGGTGAACCAGCTTGTGGAAGG + Intergenic
1119498470 14:75101813-75101835 AAGGAAAATCAGGCTGAGAATGG + Intronic
1120357176 14:83449554-83449576 AAGGGGAACAAGGTAGTGGATGG + Intergenic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121664256 14:95660001-95660023 AATGGGAATCAGGCTGAGAAGGG - Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1125457910 15:39879546-39879568 AAGGGGAGTAAGGTCAAGGAGGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1130355383 15:83125163-83125185 AGGGGCAATGGGGTTGAGGAAGG + Intronic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1134820162 16:17240278-17240300 AAGGGAGATAAGGTTGAAGAAGG + Intronic
1135594328 16:23730106-23730128 AAAGGGAAACAGGGTGAGGCAGG - Intergenic
1135823649 16:25706737-25706759 AAGGGGAATTAGGTTGCAGATGG + Intronic
1136173501 16:28502473-28502495 AATGGGAATGAGGCTGAAGATGG - Intronic
1137840439 16:51636230-51636252 AAGGGGAATCCCCTTGGGGATGG - Intergenic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1139258208 16:65563754-65563776 AAGGGTGATGAGGGTGAGGAGGG - Intergenic
1139340369 16:66264356-66264378 AAGGGGAATCAAGTTAGAGAAGG - Intergenic
1141840622 16:86571966-86571988 AGGTGGAAGGAGGTTGAGGATGG + Intergenic
1142551798 17:745328-745350 AAAGGGCTTCAGGTTGAGCAGGG + Exonic
1143095266 17:4475476-4475498 GAGGGGAGTGAGGGTGAGGAAGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1144111160 17:12034725-12034747 AACTGGAACCAGGGTGAGGATGG + Intronic
1144453810 17:15402902-15402924 AAGGGGGATGAGGTTTAGGGAGG + Intergenic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1149041520 17:52195442-52195464 TAGGGGTATCAGGTACAGGAAGG - Intergenic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152377948 17:79928338-79928360 ATGGGGAATGAGGTAGGGGATGG + Intergenic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153291879 18:3509712-3509734 GTGGGGAATGAGGTTGAGAAAGG - Intronic
1155583903 18:27343098-27343120 CAGGGGAATTAGGTTGCAGAAGG - Intergenic
1157215644 18:45781034-45781056 AAGGGAAAGGAGGTAGAGGATGG - Intergenic
1157761006 18:50265871-50265893 AAGGGGAATTAGGTTGTGAGTGG - Intronic
1159593582 18:70361030-70361052 AAGGTGAAGCAGGTACAGGAAGG + Intergenic
1161349641 19:3784753-3784775 AAGGGGTCTCAGGGTGTGGACGG + Intronic
1161713974 19:5865250-5865272 AAGGGGAACCTGGTGGTGGAAGG - Intergenic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164838830 19:31377199-31377221 GACGGGAATCAGTTTGAAGATGG - Intergenic
1166386621 19:42385823-42385845 AGGGGGAATCAGGTTCAGAAAGG + Intergenic
1167492351 19:49800029-49800051 AATGCGGATGAGGTTGAGGATGG - Exonic
1168101046 19:54141171-54141193 GTGGGGATTCAGGCTGAGGAGGG - Intronic
926242792 2:11101211-11101233 CATGGGAATCAGGTCGAGGCAGG - Intergenic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
929620058 2:43345644-43345666 GTGGGGATTCAGGCTGAGGAAGG - Intronic
930106087 2:47640563-47640585 AAGGGAAATCAGCGTGAGGCAGG + Intergenic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931685244 2:64786869-64786891 TGGGGGAATGAGGGTGAGGATGG + Intergenic
931829257 2:66034097-66034119 CATGGGTATCAGGGTGAGGAAGG + Intergenic
933299231 2:80523891-80523913 TAGGGGAAATTGGTTGAGGAAGG + Intronic
933792055 2:85890708-85890730 AAGGGGAATCTGGAAGAGAAGGG - Intergenic
935253666 2:101288587-101288609 TAAGGGAAATAGGTTGAGGAGGG - Intronic
935885707 2:107617142-107617164 AAGGGTACCCAGGTAGAGGATGG + Intergenic
936090179 2:109496779-109496801 AAGAGAAATCAGGTTGCAGATGG + Intronic
938000829 2:127735259-127735281 AGGGGTGATCAGGTGGAGGAGGG - Intronic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
939755634 2:146105769-146105791 TTGGGGAATAAGGTAGAGGAAGG - Intergenic
940433550 2:153623266-153623288 GAGGGAAAGCACGTTGAGGAAGG - Intergenic
940484684 2:154282534-154282556 AGAGGGAATGAGGTTGATGATGG - Intronic
941011733 2:160307950-160307972 AAGGGCAATCACTTAGAGGATGG - Intronic
941235352 2:162965038-162965060 TAGGGGAATCAGGTTGAAAATGG - Intergenic
941357916 2:164515174-164515196 AAGGAGGATCAGGTGGTGGATGG - Intronic
942087217 2:172454701-172454723 AAGGGGCATTAGGTTGCAGAAGG + Intronic
942862259 2:180629085-180629107 GAAGAGAATGAGGTTGAGGATGG - Intergenic
942964883 2:181880044-181880066 AAGGAGAATAAGGTAGAAGAAGG - Intergenic
942983158 2:182106441-182106463 AAGGGGAATTTGGTTGAGGGTGG + Intronic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
944822613 2:203445764-203445786 AAGGGGAACCATGTTCTGGAAGG + Exonic
945230973 2:207589481-207589503 AAGGGGAATTAGGTTGCAGATGG - Intronic
946130374 2:217601855-217601877 AAGGCTGAGCAGGTTGAGGAGGG + Intronic
946130407 2:217602135-217602157 AAGGCTGAGCAGGTTGAGGAGGG - Intronic
947592671 2:231394455-231394477 AAAGGAAAAAAGGTTGAGGAAGG + Intergenic
947654235 2:231812644-231812666 AAGGGACATCAGGTTCAGGGAGG - Intergenic
947691620 2:232142198-232142220 AAAGCAAATCAGGCTGAGGAGGG + Intronic
948375737 2:237519199-237519221 AAGGGGAAGCAGCTGGAAGAAGG + Intronic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1168940354 20:1706357-1706379 AAGGGGAGTCAGGCAGAGGGAGG - Intergenic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169586590 20:7092570-7092592 AAGGGTTTTCAGGCTGAGGAAGG - Intergenic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1170138203 20:13099070-13099092 AAGGGAATTCAGGTTGCAGATGG + Intronic
1170533025 20:17313581-17313603 TTGGGGAATGAGGTTGATGAGGG - Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1172464336 20:35144622-35144644 AAAGGGTATCAGGCTGAGCATGG - Intronic
1173153632 20:40588990-40589012 AAGGGGAATTAGGTTGCCGATGG - Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174327303 20:49789634-49789656 AAGAGGAACCATATTGAGGATGG - Intergenic
1176093951 20:63331048-63331070 ATGGCGAATCGGGTTCAGGAGGG + Intronic
1177195574 21:17900797-17900819 AAGGGCCATCAGGTTGGGGTGGG + Intergenic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1178452336 21:32714237-32714259 AAGTGGTAACAGGTTGAAGAGGG + Intronic
1180662162 22:17477352-17477374 AAGAGGAATGGGGTTGGGGAGGG + Intronic
1180727632 22:17958485-17958507 ACGGGGGATGAGGGTGAGGATGG - Intronic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1180832470 22:18913079-18913101 AAGGTGAATCTGTGTGAGGATGG + Exonic
1181018160 22:20083187-20083209 AAGGGGAGGCAGTTTTAGGAAGG - Intronic
1181067372 22:20313263-20313285 AAGGTGAATCTGTGTGAGGATGG - Intergenic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181434362 22:22901586-22901608 AAGGGGTGTCTGGGTGAGGAAGG - Intergenic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1182102423 22:27667526-27667548 AAGGGGAATATGGGTCAGGAAGG + Intergenic
1183218266 22:36495354-36495376 AAGGGCAGTCAGGTAGAAGAGGG - Intronic
1183245151 22:36687645-36687667 AAGGGGATTAAGGTTGCAGATGG + Intronic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183713012 22:39517507-39517529 AAGGGGAATCAGCTTCAGGATGG + Exonic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1203282556 22_KI270734v1_random:138384-138406 AAGGTGAATCTGTGTGAGGATGG + Intergenic
949455607 3:4235217-4235239 AAGGGGGATAAGGGAGAGGAAGG + Intronic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949597725 3:5565507-5565529 AAGAGGAATCAGGGGGAGGGTGG - Intergenic
949903294 3:8837713-8837735 AAGGGTAAGCAGGTTTAAGATGG + Intronic
950453146 3:13076852-13076874 ACGGGGAATAAGATTTAGGAGGG - Intergenic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
951128983 3:19018883-19018905 CAGGGGAGTCAAGTTGATGAGGG - Intergenic
952141650 3:30485799-30485821 ATGGGTAATCAGTTTAAGGAAGG + Intergenic
952921626 3:38289236-38289258 TAGGGGAATCTGGGTGTGGAAGG - Intronic
953881729 3:46694412-46694434 AGGGGGAATCAGGCTGCTGACGG - Intergenic
953888595 3:46734170-46734192 AAGGGGAAGCTGGTAGAGGTAGG - Exonic
954089704 3:48274439-48274461 TAGGGGTATTAGGTGGAGGATGG - Intronic
954920431 3:54186135-54186157 GATGGGAATGAGGGTGAGGATGG + Intronic
955989683 3:64613132-64613154 AAGGGTAATCAGCTCCAGGAGGG + Intronic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
958101974 3:89023646-89023668 AAGGGATTTCAGGTTCAGGAAGG + Intergenic
960168349 3:114429551-114429573 GAGGGTATTGAGGTTGAGGATGG + Intronic
960876255 3:122297993-122298015 AAGGGGAATTAGGTTGCATATGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961405482 3:126676804-126676826 AAGGGGATGCACCTTGAGGAAGG + Intergenic
961681102 3:128600745-128600767 AGGGGGCAGCAGGTAGAGGAGGG - Intergenic
962401838 3:135067300-135067322 AAGGGCAATGAGGTGGAGGCAGG + Intronic
962403500 3:135081080-135081102 GAGGAGAATCAGGTGAAGGAGGG + Intronic
962849952 3:139300975-139300997 AAAGTGAACCAGGTTGGGGAGGG + Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
963272086 3:143295462-143295484 AAGAGGAATCAGGTTCAGAGTGG - Intronic
963490639 3:145995728-145995750 AAGGGAAATCAGATTGCAGATGG - Intergenic
964612244 3:158627112-158627134 CAGGGGTATTAGGTGGAGGATGG + Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967720573 3:192811768-192811790 ATGGGGATTAAGGTTGGGGAGGG + Intronic
968603858 4:1522371-1522393 AAGGGGCATGAGGGTGAGGGGGG - Intergenic
969143332 4:5099282-5099304 AAGGGGACTTAGGTTGCAGATGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969629240 4:8325927-8325949 AAAGGGGATCAGGCTGGGGAAGG - Intergenic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970155469 4:13137261-13137283 AAGGGTCTGCAGGTTGAGGAAGG + Intergenic
970415299 4:15850927-15850949 AAGGGGTATCCTGTTGAGCAAGG - Exonic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971185849 4:24375193-24375215 AAGGAAAATCAGGTTGAGTTGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972761337 4:42107716-42107738 AAGGTGAATCGGGTTGAGTGTGG - Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974356642 4:60821074-60821096 AAGAGTAATCAGATTGAAGATGG - Intergenic
975189998 4:71449436-71449458 AAAGAAAATAAGGTTGAGGATGG + Intronic
976836048 4:89375167-89375189 AAGGAAAATCAAGTTGAGAATGG - Intergenic
978670711 4:111244499-111244521 AAGGACCATCAGGTTGGGGAGGG - Intergenic
981020697 4:140024965-140024987 AAGAGTAATGGGGTTGAGGATGG - Intronic
981425653 4:144600122-144600144 AAAGGGAATAAGGGTGAGGTAGG + Intergenic
982678538 4:158403208-158403230 ATGGGGCAGCAGGTTGAGCAGGG + Intronic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
986734619 5:10659912-10659934 AAGGGAAATGGGGTTGGGGAGGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987276332 5:16366743-16366765 ATGAGGAATGAGGTTGAGGTAGG + Intergenic
987785037 5:22488733-22488755 CAGGGTAAGCAGGTTTAGGATGG - Intronic
988903704 5:35762675-35762697 AAGGGCTATCAGCTTGGGGAAGG - Intronic
989243721 5:39229726-39229748 AAGGGCAATCAGGTTTAGAGAGG + Intronic
989446501 5:41535913-41535935 AAGGGCAATCAGGCAGTGGAAGG - Intergenic
989654266 5:43728374-43728396 AAAGGGAACCATGTTGAGTATGG - Intergenic
992523053 5:77576302-77576324 AAGGGGTGTCAGGTTGAGGGGGG - Intronic
993098516 5:83508097-83508119 AAGGGGAATGAGGCAGAGCAGGG - Intronic
994215456 5:97132454-97132476 CAGAGGAATGAGGTTGAGGGAGG + Intronic
995847494 5:116509735-116509757 AAGGGGACCCAGGCTGAGGTGGG + Intronic
996315677 5:122158219-122158241 AAGAGGAAACATGTGGAGGAAGG + Intronic
999110283 5:149114372-149114394 AAGGGGAATGTGATTAAGGAGGG + Intergenic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1001274232 5:170338772-170338794 ATGGGGGAGCAGGTTGAGGGTGG + Intergenic
1001442199 5:171751508-171751530 AAGGGGAATGTGGTTGGGAAGGG - Intergenic
1001936870 5:175711723-175711745 AAGGGGAATGGGGTTGCAGAGGG + Intergenic
1002542592 5:179915867-179915889 AGGGTGAATCTGGATGAGGAGGG - Intronic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003628426 6:7764855-7764877 TAGGGGAGTGAGGTCGAGGAGGG + Intronic
1004014552 6:11720161-11720183 AAGGGGGCTCAGGCTGTGGAAGG + Intronic
1004028615 6:11843815-11843837 GAGGGGAATCAGGGTGAGTGGGG + Intergenic
1005246518 6:23891852-23891874 AAGGGGATTAAGGTTGCAGATGG - Intergenic
1005429285 6:25737339-25737361 AAGTGGACTCAGCTTCAGGAAGG + Intergenic
1006441952 6:34058585-34058607 GAGGGGATTCAGGGTGAGGCAGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007852030 6:44812540-44812562 AAGGGAAATAAGGTTGCAGATGG - Intronic
1008121452 6:47621951-47621973 AAGGGCCATCAGGTTGGGGCAGG + Intronic
1010510213 6:76709000-76709022 AATGGGAACCAGGCAGAGGAAGG + Intergenic
1011015648 6:82751782-82751804 AAATGGAATCAGGTTAAAGAAGG + Intergenic
1012458788 6:99436801-99436823 AAGGTGAATCCAGTTGAGGCTGG + Intronic
1012648159 6:101716023-101716045 AAGGGGAAGCAGGTAGAAGGTGG - Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013505234 6:110793664-110793686 AAGGGAAAACAGGTTGTGAATGG - Intronic
1013670454 6:112396696-112396718 AAGGAGAATGAGGTTGGGAAAGG - Intergenic
1014044330 6:116866997-116867019 AAGGAGGAGCAGGTTGAAGAAGG - Intergenic
1014189286 6:118474480-118474502 AAGGGGATTGAGGTAGAAGAAGG - Intronic
1015629209 6:135214429-135214451 AAGGGGAATGAAGGTGAGAATGG - Intronic
1015759901 6:136647622-136647644 AAGGGGAAACGTGTTGAGGGAGG - Intronic
1016561143 6:145396284-145396306 AAAGGGAATGAGGGAGAGGAAGG - Intergenic
1017347808 6:153405155-153405177 CAGACGAATCAGGTTGTGGATGG - Intergenic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1019832737 7:3349387-3349409 AAGGGGAATGGGGCTGGGGAGGG + Intronic
1020155902 7:5724232-5724254 AAGGGCAGTCAGGCTGATGAAGG + Intronic
1021930832 7:25579746-25579768 TCGGGGAATCAGTCTGAGGATGG - Intergenic
1022680264 7:32538605-32538627 GAGGAGAATGAGGTTGGGGATGG - Intronic
1024283625 7:47738914-47738936 AAGGGGCAGCAGGTGGGGGAGGG - Intronic
1024730378 7:52247155-52247177 ATGGGGAATCATCTTGAGGGAGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026816760 7:73519425-73519447 AAGTGGAAGCACTTTGAGGATGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029354482 7:100041582-100041604 AAGAGTAGTGAGGTTGAGGAAGG + Exonic
1030960387 7:115913090-115913112 AATGGGAATAAGGGTGAGGATGG - Intergenic
1031183971 7:118452494-118452516 AAAGGGAAACATGTTTAGGAGGG + Intergenic
1032248689 7:130234332-130234354 AAGGGGCCCCAGGTGGAGGAGGG + Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034198708 7:149267177-149267199 AAGGGGAATGAAGTAGAGGTGGG + Exonic
1034748182 7:153542747-153542769 AAGGGGAAACAGGGAGATGATGG + Intergenic
1034843562 7:154422228-154422250 CAAGGAAATCAGGTTGAGGCTGG + Intronic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035589299 8:800985-801007 AAGGTGTATCAGGCTGTGGACGG - Intergenic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036581645 8:10080990-10081012 AACGGGAAACAGGCTGAGGTTGG + Intronic
1037109636 8:15150485-15150507 AGGGGGAATTAGGTTTGGGAGGG - Intronic
1037455249 8:19057064-19057086 AAGGGGAACCAGTTTTAAGAAGG - Intronic
1038321196 8:26528841-26528863 AAGGGTAAACAGGTTTAGGGAGG + Intronic
1038417948 8:27411276-27411298 AAGAGGATTCAGGCTGAGGAAGG + Intronic
1038999313 8:32962228-32962250 TAGGGGAATGAGATTGGGGATGG + Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039965380 8:42280253-42280275 CAGGGGAAGCAGGTTGTGGTGGG - Intronic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041696324 8:60740824-60740846 CAGGGGAATAAGGTTAAGGGCGG + Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1042105066 8:65317396-65317418 AAGGGGAAGCAGGTACAGGCAGG + Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042494336 8:69439316-69439338 AAGGGAAATCAGGGTGGGGCAGG + Intergenic
1045420514 8:102010071-102010093 AAGGGGCCCCAGGTTGGGGAGGG + Intronic
1045508544 8:102795440-102795462 AAGGGGGGTCAGGTGGAGGGAGG + Intergenic
1045598171 8:103681416-103681438 AAGGGAAATCAAATTGGGGAAGG + Intronic
1046981876 8:120345396-120345418 GCTGGGAATCTGGTTGAGGATGG - Exonic
1047201766 8:122773190-122773212 AAGGGGTATAAGGATGTGGATGG + Intergenic
1047725429 8:127679950-127679972 AAGAGGACTCAGGGTGGGGAAGG + Intergenic
1048200621 8:132371169-132371191 AAGGAGAGTCAGATTGAAGATGG - Intronic
1048661314 8:136605132-136605154 AAAGGGAATCAGTATGAGCATGG - Intergenic
1049532373 8:143160753-143160775 AACGGGTATGAGGTTGGGGAGGG - Intergenic
1049845174 8:144797280-144797302 CAGGGGAAACTGGGTGAGGAGGG - Intergenic
1051361609 9:16286060-16286082 TATGGGAATGAGGTTGGGGAGGG + Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058432829 9:104933991-104934013 GAGAGGAATCAGTTTCAGGAAGG - Intergenic
1059382446 9:113936976-113936998 GAGGGGAATGAGGTTGGGGAAGG - Intronic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1061636873 9:131917009-131917031 AAGGGGCAGCAGGTGGAGAAGGG + Intronic
1061652531 9:132062475-132062497 AAGGGCCAGCAGGTTGAGTATGG + Intronic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187427120 X:19188039-19188061 AAGGGGCCCCAGGTGGAGGAGGG - Intergenic
1189222070 X:39381167-39381189 AAGGGGAAAGAGGTAAAGGATGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190451390 X:50584777-50584799 AGAGGGAATCAGGTTCGGGAGGG + Intergenic
1193861845 X:86677832-86677854 AAGATAAATGAGGTTGAGGATGG - Intronic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197974448 X:132151696-132151718 AAGGGAAATTAGGTTGCAGATGG + Intergenic
1197976035 X:132166905-132166927 GATGGGGAGCAGGTTGAGGATGG - Intergenic
1198035506 X:132797713-132797735 AAAGGGAGTCAAGTTGAGGCCGG + Intronic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1199105289 X:143859096-143859118 AAAGGGGATGAGGTTGGGGATGG + Intergenic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic
1201934687 Y:19395895-19395917 AAGGACCATCAGGTGGAGGAAGG + Intergenic