ID: 1122684249

View in Genome Browser
Species Human (GRCh38)
Location 14:103492399-103492421
Sequence ATGATTATGAAAGACATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122684249_1122684250 -8 Left 1122684249 14:103492399-103492421 CCATGCATGTCTTTCATAATCAT 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1122684250 14:103492414-103492436 ATAATCATCTCCAGCCCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122684249 Original CRISPR ATGATTATGAAAGACATGCA TGG (reversed) Intronic
902325507 1:15697659-15697681 AAGAAAAAGAAAGACATGCAGGG - Intronic
903247868 1:22029461-22029483 ATCATGATGAAAGAGATGGAGGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
907312322 1:53546001-53546023 AGGATTAAGGAAGACATGGATGG + Intronic
908086233 1:60637248-60637270 ATGATTAGGAAAGACAACTAAGG + Intergenic
908769069 1:67580093-67580115 GTGATTAGAAAAGACATGAATGG + Intergenic
910001932 1:82351789-82351811 ATGATTATGACTGAAATGAAAGG + Intergenic
910568981 1:88679208-88679230 AAGATTTTGAAAGCCAGGCAGGG - Intergenic
911110877 1:94183843-94183865 ATGATTATTAAAGACCTCCTTGG + Intronic
912039936 1:105377310-105377332 ATTATAATGAAAGATATGTAAGG + Intergenic
913057785 1:115178273-115178295 ATGATCTTGAAAAACATACATGG + Intergenic
913389310 1:118292905-118292927 ATGCCTATGAATGACAAGCAGGG + Intergenic
916962744 1:169905506-169905528 ATGATTATCATAGCCAGGCACGG - Intergenic
918423159 1:184384564-184384586 ATGATGATGAAATAAATGAAGGG + Intergenic
918607441 1:186445291-186445313 ATGTTTATGAAAAACATACCAGG + Intronic
919669154 1:200323054-200323076 CTGATTGAGAGAGACATGCACGG - Intergenic
919974987 1:202604462-202604484 ATGAACATGAAGGACATGAAAGG - Exonic
920526171 1:206668280-206668302 ATGATTACTAAAGACAGTCAAGG + Intronic
920814260 1:209316156-209316178 ATTATTATCAAGGACATGAATGG - Intergenic
922004710 1:221518190-221518212 AAGAATATGAATGACAAGCAGGG - Intergenic
922204507 1:223434920-223434942 GGGATAAAGAAAGACATGCATGG + Intergenic
922568845 1:226619786-226619808 ATGTTTATGAAAGAAATCAAAGG - Intergenic
923720771 1:236464882-236464904 GTGATTATGAAAGAAATGACTGG - Intronic
923777053 1:236988643-236988665 ATGCTTATGAAATTCATCCATGG + Intergenic
1064049590 10:12048638-12048660 ATGATTAAGAACGAAATCCAGGG - Intergenic
1065162664 10:22939109-22939131 TTGATTGTGAAAGACAAGGAAGG + Intronic
1065481222 10:26195719-26195741 TTGATCATGAAAGACAAGAAGGG - Intronic
1068507670 10:57922909-57922931 GTGATTATAACAGACAAGCATGG + Intergenic
1069622418 10:69846154-69846176 TTGGTTAAGAGAGACATGCATGG - Intronic
1070515049 10:77197298-77197320 ATTATTCAGAAAGACATGAAAGG + Intronic
1071025539 10:81108527-81108549 ATGATTATGACGTACATCCATGG - Intergenic
1077022190 11:422230-422252 AGGAGCATGAAAGACTTGCAGGG + Intronic
1077632104 11:3817738-3817760 AAGATGATGATAGAAATGCAAGG + Intronic
1079572627 11:21963655-21963677 ATGATAATGACAGACAATCAGGG - Intergenic
1080721592 11:34854519-34854541 ATTATTATGAAGGACATAGAGGG + Intronic
1083315574 11:61813089-61813111 ATGACTATGCAAGAGAAGCAGGG + Intronic
1085668488 11:78438939-78438961 ATGATTAATAAAGACTTTCAAGG + Intronic
1088364345 11:109023236-109023258 ATGGTTATGCAAGAAATACAGGG - Intergenic
1091825708 12:3511184-3511206 ATGATAAGGGAAGACAGGCATGG - Intronic
1092850474 12:12621636-12621658 ATGAGGATGAAAGATAAGCAGGG + Intronic
1092867147 12:12772925-12772947 ATGAAAATGAAAGCCAGGCATGG + Intronic
1093089743 12:14908051-14908073 ATGATTGTGAAATACAAGAATGG - Intergenic
1095489117 12:42714683-42714705 ATGAATAAGAAAGACAAGGACGG + Intergenic
1096719692 12:53511965-53511987 ATGAAGATGACAGACATGAAAGG + Intronic
1097086215 12:56470232-56470254 ATGATTATGACAGACTGGCTGGG - Exonic
1097155855 12:57011886-57011908 ATGATTCAGGAAGAAATGCAAGG - Intronic
1097511569 12:60548865-60548887 ATGATGGAGAAAGACATTCAAGG - Intergenic
1097862229 12:64529171-64529193 ATGATTAGAAAAGACATTTAAGG - Intergenic
1098500927 12:71190745-71190767 ATGACAATGATAGACATACAAGG + Intronic
1099140227 12:78964330-78964352 ATGATTATGAAATATAAGAAAGG - Intronic
1100030438 12:90182087-90182109 AGGATTAGGAAAGACATAAAAGG + Intergenic
1100088961 12:90947029-90947051 ATGAGTCAGAAATACATGCATGG + Intronic
1101861183 12:108483691-108483713 GGGAATAGGAAAGACATGCATGG - Intergenic
1102672236 12:114629941-114629963 ATGATAATAAAATAAATGCAGGG + Intergenic
1104513780 12:129405031-129405053 ATGATATTGAAAGATATACATGG - Intronic
1107550639 13:41471489-41471511 CTGATTATGAAAGTAATGCCTGG - Intergenic
1108051424 13:46444618-46444640 AAGATTATCAAATACATGGAGGG - Intergenic
1108820011 13:54336847-54336869 CAGATTCTGAAAGACATGCATGG - Intergenic
1109543979 13:63818242-63818264 AAGATTATTAAATACATGGAGGG - Intergenic
1110003975 13:70242025-70242047 ATAATTAAGAAAGATATGCTTGG + Intergenic
1112871703 13:103979060-103979082 ATAATTATGAATGGAATGCATGG + Intergenic
1115231479 14:31165486-31165508 AGGATTATTAAAGACCTGTAAGG - Intronic
1116328035 14:43558903-43558925 ATGATTATCAGAGGCAGGCAAGG - Intergenic
1117387591 14:55231680-55231702 AAGATTAATAAAGACAAGCAAGG + Intergenic
1117399316 14:55344333-55344355 CTGATTATGAAAGTAATACATGG + Intronic
1119711703 14:76827307-76827329 AGGATTAAGAAAGACCTGCATGG + Intronic
1121275990 14:92668012-92668034 ATTATTATGAAAGACAGGAGGGG - Intronic
1122007300 14:98716094-98716116 CTGGTTAAGAAAGACATGGAGGG - Intronic
1122684249 14:103492399-103492421 ATGATTATGAAAGACATGCATGG - Intronic
1123838587 15:24223325-24223347 ATGTAAATGCAAGACATGCAAGG - Intergenic
1124156314 15:27227849-27227871 ATGATGAAGAAAAACATGCTGGG - Intronic
1124219608 15:27838032-27838054 ATTATTAGGAAAGCCTTGCACGG - Intronic
1126238342 15:46411790-46411812 ATGATTCTGATGGACATGAAGGG - Intergenic
1130567564 15:85009972-85009994 ATGCTTATGAAATTCATGCATGG - Intronic
1131076320 15:89496978-89497000 CTGATTATGAAATTCATACAGGG + Intergenic
1133427204 16:5703079-5703101 ATGATGATGAAAAAGATGCCAGG + Intergenic
1138323101 16:56136123-56136145 ATGATTATGAGAGTCAGGCTAGG - Intergenic
1140107892 16:71977505-71977527 AGGATTTTGAAAGACATCAATGG - Intronic
1144113037 17:12057294-12057316 TGGATTTTGAAAGACAGGCAGGG + Intronic
1145851196 17:28098970-28098992 ATGGTAATGAAAGCCAGGCACGG - Intronic
1146206447 17:30909017-30909039 ATGATTATGAATGACCTATAGGG + Intronic
1149745873 17:59097565-59097587 AAGAATTTGAAAGACATACATGG + Intronic
1150061250 17:62070109-62070131 ATGATTCTGAAAAATCTGCAAGG + Intergenic
1153750118 18:8220876-8220898 ATGATTATAAAGGAGATGTAGGG - Intronic
1156393035 18:36670850-36670872 CTAATTATGCAAGACCTGCAAGG - Intronic
1157417627 18:47519251-47519273 ATGAATATAAAAGACAAGAAAGG + Intergenic
1157575587 18:48741109-48741131 ATGATAATGAATGACGTGCATGG - Intronic
1159294439 18:66465854-66465876 ATGTTTATGAAATACATTTACGG + Intergenic
1159771843 18:72555394-72555416 ATGAAAATGAAAGAAATTCACGG + Intronic
1160412473 18:78684285-78684307 ATGGATATGAGAGACATCCAGGG - Intergenic
1162702800 19:12530611-12530633 ATGATTATAAAATACACGAAGGG + Intronic
1165470366 19:35999924-35999946 ATGGCTATAAAAGACATACAGGG + Intergenic
1166033227 19:40148518-40148540 ATGATTATAAAAGTAATTCATGG - Intergenic
1166037963 19:40182987-40183009 ATAATTATGAAAAACAGGCTGGG + Intergenic
1167997434 19:53417762-53417784 AGGATTTTGAAAGACATGAAAGG - Intronic
925692203 2:6536885-6536907 AAGATTTTGAAAGAAATGTATGG - Intergenic
927389079 2:22572652-22572674 ATGATTATAAAGTAAATGCAGGG + Intergenic
927736692 2:25530061-25530083 ATAATTATGAAAAACAGGGATGG + Intronic
927800007 2:26089784-26089806 ATGATTAAGAAAGAGGTGCCAGG - Intronic
928752674 2:34488539-34488561 AAGATTTTGAAAAACATGGAAGG + Intergenic
930281135 2:49371302-49371324 TATATGATGAAAGACATGCAGGG - Intergenic
930703765 2:54484994-54485016 ATGTTTATGAAAGACAGTGAAGG + Intronic
931904753 2:66830550-66830572 ATGATGAAGAAAGACTTGAAGGG + Intergenic
931954164 2:67398630-67398652 AGTATTATTAAAGACATGTAAGG - Intronic
932088135 2:68780613-68780635 ATGAGGATGAAAGACAAGGAAGG - Intronic
933516708 2:83313228-83313250 ATGAAAATGAAGGACATGCACGG + Intergenic
933668292 2:84982708-84982730 ATGATATTGAAATACATGCTGGG + Intronic
935547769 2:104418892-104418914 TGGATTATGTAAGACATGAAAGG - Intergenic
936647650 2:114389802-114389824 ATGATTATTAAACACATGCAGGG + Intergenic
938977356 2:136492576-136492598 ATCCTTATAAAAGACAGGCAGGG - Intergenic
939484719 2:142796652-142796674 ATGTTTATGAAAATCATTCAGGG + Intergenic
939766601 2:146257744-146257766 ATGAGTATGAAATTCATGCCAGG - Intergenic
940040866 2:149359213-149359235 ATGAAAATCAAAGACATGCATGG - Intronic
940043655 2:149386910-149386932 ATGATTGTGCACTACATGCAAGG - Intronic
941046726 2:160684238-160684260 ATGAATATGAAAGAGAGGCTTGG - Intergenic
942638866 2:178039117-178039139 ATGTTTTTGCAGGACATGCAAGG + Intronic
942756586 2:179348377-179348399 AACATTTTAAAAGACATGCATGG + Intergenic
944643288 2:201750634-201750656 CTGATTATGAAAGTAATTCATGG + Intronic
1169539288 20:6581719-6581741 ATGATTTTGAAAGCCATGTTTGG - Intergenic
1169646659 20:7818465-7818487 ATCATTATGTAATACTTGCATGG - Intergenic
1171348171 20:24482140-24482162 ATGACTAAGAAAGAAATACATGG + Intronic
1171961742 20:31499631-31499653 ATAATTATAACACACATGCATGG - Intergenic
1172708030 20:36897231-36897253 ATGAATATGATTGGCATGCAGGG - Intronic
1172830416 20:37829369-37829391 ATGGTTAAGAAAGACACACATGG - Intronic
1174896547 20:54455405-54455427 ATGACTATGAAAGAAATGATTGG + Intergenic
1175228303 20:57458118-57458140 AGGATAATGAATGAAATGCATGG - Intergenic
1177346041 21:19872324-19872346 AAGATTCTGAAAAAAATGCAGGG + Intergenic
1177569074 21:22862655-22862677 AAGATTAAGAAAGAGAAGCATGG - Intergenic
1178152557 21:29812269-29812291 ATGAATAAGAAAGACAGGCATGG + Intronic
1178227447 21:30739151-30739173 ATGTTTATGAAAAAAATGCAAGG - Intergenic
949962404 3:9323442-9323464 ATGATTCTCAAAGACTGGCAGGG + Intronic
951351375 3:21611081-21611103 AAGATTGTAACAGACATGCATGG - Intronic
953121632 3:40049040-40049062 ATGATTATGACTGATATGTATGG - Intronic
953152991 3:40342300-40342322 ATGAATATGATAGAAAAGCAAGG - Intergenic
953279891 3:41544460-41544482 ATGATGAAGAAAGACCTGAAGGG - Intronic
955004984 3:54960098-54960120 GTGATTATGAAAGAAATGTGTGG + Intronic
956928034 3:74010398-74010420 ATATATATGAAAGACATCCAGGG + Intergenic
957327772 3:78718499-78718521 ATCATCAGGAAAGACATGCTTGG + Intronic
957830164 3:85506117-85506139 ATGATGATGAAAATAATGCAGGG - Intronic
959987522 3:112592129-112592151 ATGATTATGAGAGACAAAGAAGG - Intergenic
960146572 3:114210196-114210218 ATGAATGGGAAAGACATGTATGG - Intergenic
960168741 3:114433999-114434021 ATGTTTATCAAAAACATGCATGG + Intronic
960316285 3:116181563-116181585 ATCATTATGCAACACTTGCAAGG - Intronic
960778432 3:121289240-121289262 ATATTTAAGAAAGACATGAAGGG + Intronic
961444050 3:126970438-126970460 ATGATTATGTTACACATACAAGG - Intergenic
962534419 3:136315075-136315097 ATGATTATGAAAGACAAAGATGG + Intronic
963572083 3:147010112-147010134 ATGAATAAGAAAGAAATGAAAGG - Intergenic
964177294 3:153839669-153839691 ATCATTTTGAAAGACATGTAAGG + Intergenic
964236830 3:154541117-154541139 CTCATTAGGAAAGACAGGCAAGG + Intergenic
964548156 3:157858101-157858123 ATGCTTATTGAAGAAATGCAAGG - Intergenic
964760523 3:160131293-160131315 ATGATTACAAATGACATGGAGGG - Intergenic
967670260 3:192225331-192225353 ATGATTATAAAAGTCAGGCAAGG - Intronic
970476062 4:16424607-16424629 ATGGTTAAGAAAGAAATGAAGGG - Intergenic
971103430 4:23495800-23495822 AGGATTATTAAAGAAATGCTGGG + Intergenic
971964726 4:33538681-33538703 AAGATCCTGAAACACATGCAAGG + Intergenic
972995280 4:44871249-44871271 AAGATTTTGACAGTCATGCAGGG - Intergenic
973049707 4:45581122-45581144 TTGATTATCAGAGACTTGCAAGG - Intergenic
973535127 4:51873316-51873338 ATAATCATGAATGACAGGCAGGG - Intronic
973650821 4:52995613-52995635 TTTATTGTGAAAGACATGAAAGG - Intronic
975101250 4:70515619-70515641 ATGATTATGAAATAACTTCAGGG - Intergenic
976387033 4:84472386-84472408 ATGTTTATGAAAAGCATTCAGGG - Intergenic
978825476 4:113017399-113017421 AAAAATATCAAAGACATGCATGG - Intronic
979000754 4:115215577-115215599 ATGATAATGAAATAAATGAATGG - Intergenic
980019012 4:127686068-127686090 CTGATTATGAAAGATATTAAGGG + Intronic
982382874 4:154768556-154768578 ATGATGATGTCAGACATTCAAGG + Intergenic
983284754 4:165725573-165725595 ATGATTAGAAAACACTTGCAGGG - Intergenic
985024347 4:185724993-185725015 CTGAGCATGAAAGATATGCAAGG - Intronic
986207028 5:5634506-5634528 ATAATTTTGGAAGACCTGCATGG + Intergenic
986951017 5:13084977-13084999 ATAATTATGCAACACATCCAAGG - Intergenic
987846098 5:23288909-23288931 ATGATCATGAGAAACAAGCATGG + Intergenic
988046666 5:25964139-25964161 ATGATTATGCAAGAAATGATAGG - Intergenic
988807828 5:34756686-34756708 AAGACTAAGAAAGACATGAAAGG - Intronic
989281185 5:39645411-39645433 AGGATTATAAAGGACAGGCAAGG - Intergenic
990763397 5:59155625-59155647 AAGATTGTGAGAGACATGAATGG + Intronic
991303865 5:65155654-65155676 AAGATTATGAAACTCATGCTGGG + Intronic
992741564 5:79778695-79778717 ATTATTATAAAAAATATGCACGG - Intronic
993053978 5:82959134-82959156 ATGTTCATGAAACACATGCTTGG - Intergenic
994448047 5:99902914-99902936 AAGACAATGAAAGACATGTACGG + Intergenic
994662305 5:102668799-102668821 ATGATCATGAATGGCATGAATGG + Intergenic
995303072 5:110608500-110608522 CTGATTATGAAATATATTCAGGG - Intronic
995976068 5:118036007-118036029 ATGCTTATGAAAGACAAGTGAGG + Intergenic
996217592 5:120888211-120888233 ATGACTATGTAAAACATGAAAGG - Intergenic
997270522 5:132532852-132532874 ATGATCATGAAAAAAATGCTTGG + Intergenic
997555316 5:134792534-134792556 ATGATTGGGAAAGACATTAAAGG - Intronic
1000736379 5:164906838-164906860 AAGATTTTAAAAGACATGGAAGG + Intergenic
1001744354 5:174079554-174079576 CTGATAATGAAAGATGTGCATGG - Intronic
1002663698 5:180807779-180807801 AAGATGATGAAACACATTCAGGG + Intronic
1003364869 6:5463816-5463838 AGGAAAATGAAAGAAATGCAGGG - Intronic
1005832074 6:29679503-29679525 ATGGTTTTGAAAGACAGGAAAGG - Intronic
1007203133 6:40127910-40127932 TTGATAATCAAAGACATGAAAGG - Intergenic
1008365494 6:50674320-50674342 ATGATGTTGAAAGAAATTCAAGG - Intergenic
1008826346 6:55698809-55698831 ATAAATATGAAAGACAAGCAGGG - Intergenic
1010839940 6:80637016-80637038 ATTATTAATAAAGACATACATGG - Intergenic
1011933645 6:92745914-92745936 CAGAGTATGAAGGACATGCATGG - Intergenic
1012580536 6:100863921-100863943 ATAATTATGAAAGACAGTCCTGG - Intronic
1012796767 6:103771850-103771872 ATAAATATGACAGACATGTATGG - Intergenic
1013606560 6:111754626-111754648 ATGCTTATGAACAACAGGCAAGG + Intronic
1013814176 6:114077953-114077975 GTCATTATGAAAGAAATACATGG - Intronic
1014126924 6:117786984-117787006 TTGTTTATCAAAGACATGCCAGG - Intergenic
1014380667 6:120736964-120736986 AAGATAATGAAGGAAATGCATGG + Intergenic
1015764053 6:136697008-136697030 GTGATTGTGAAAGACTTGTATGG - Intronic
1016058964 6:139608495-139608517 ATAATTAAGAAGGAAATGCAAGG - Intergenic
1016607796 6:145952832-145952854 AAGATTATGACATACATGCTAGG + Intronic
1018417538 6:163614004-163614026 AGGTTTATGAAAAACACGCAGGG - Intergenic
1019796507 7:3053716-3053738 TTTATTATGAAAGAATTGCACGG - Intergenic
1021299372 7:18953500-18953522 AAGATTATGATAGATTTGCAAGG + Intronic
1022546499 7:31194043-31194065 ATGACTTTGAAAGTCATGCAGGG - Intergenic
1022732994 7:33048701-33048723 ATGATTATGGCAGGCATTCAGGG + Intronic
1023165042 7:37335465-37335487 ATGCTTATGAAAAATATGGAAGG + Intronic
1024159130 7:46656382-46656404 ATGATTCTGCATGATATGCAGGG - Intergenic
1024441977 7:49430455-49430477 ATGTCTATGAGAGACAAGCAAGG - Intergenic
1027846358 7:83381537-83381559 ATGATAAAGAAAAAAATGCAAGG - Intronic
1031740904 7:125429374-125429396 ATGATTATGAAAGAATTTTATGG - Intergenic
1031781899 7:125978655-125978677 ATCATTATGAGAGACTGGCAGGG + Intergenic
1033959009 7:146889785-146889807 ATGATCAAGACAGACATGCCTGG - Intronic
1033993884 7:147321318-147321340 AAGGTTATGAAAGACATCCTGGG + Intronic
1036097739 8:5742023-5742045 GAGATCATGAAAGACATGCAGGG - Intergenic
1038434211 8:27523317-27523339 ATGATTATGAATGAAATGGTGGG - Intronic
1040452339 8:47560688-47560710 CTGATTATGAAAGTCATAAATGG - Intronic
1042057208 8:64777230-64777252 ATAATTAGCAAAGACATGAAGGG + Intronic
1043399848 8:79873089-79873111 AAGATTATGAAGGCCAGGCACGG - Intergenic
1044133053 8:88550204-88550226 ATCTTTGTGAAAGACATGTATGG - Intergenic
1044640256 8:94372584-94372606 ATGATGAAGAAACACAGGCATGG + Intronic
1045623349 8:104009963-104009985 ATCATTGTGAAAGATATGGATGG + Intronic
1045765071 8:105657841-105657863 ATGATTAAAAAATAAATGCATGG - Intronic
1046123905 8:109880668-109880690 ATGATTTTGGAAGACGTGTATGG + Intergenic
1046687234 8:117241276-117241298 ATGAAGAAGAAAGACATGCTGGG - Intergenic
1047637577 8:126781336-126781358 ATGAATATGAAGGACAAGGAGGG + Intergenic
1047766010 8:127990558-127990580 ATGAATTTGAAAGCTATGCAAGG + Intergenic
1048436713 8:134425078-134425100 ATGATCCAGAAAGACATCCAGGG + Intergenic
1048926148 8:139273491-139273513 ATGATTTTGAAATTCATCCACGG + Intergenic
1051546891 9:18286303-18286325 ATGTTCATGAAATACATGAATGG + Intergenic
1051939414 9:22487291-22487313 ATGATAATTAAAGACATGATAGG - Intergenic
1051951457 9:22638916-22638938 ATATTTATTAAAGACATGGATGG - Intergenic
1052068889 9:24057173-24057195 TTGACTATCAAAGAAATGCATGG + Intergenic
1052574660 9:30277191-30277213 AAGATTCTGAAATACAGGCAGGG + Intergenic
1056621439 9:88217938-88217960 ATGCTACTCAAAGACATGCAAGG + Intergenic
1057596707 9:96420666-96420688 AAGAGAATGAAAGACATGCCAGG + Intergenic
1058910991 9:109519860-109519882 ATGATTAAGAAATGCATCCAAGG + Intergenic
1059759624 9:117325633-117325655 GTAATTAGGATAGACATGCAGGG + Intronic
1060561913 9:124552434-124552456 ATGAGTTAGAAAGACAGGCAGGG + Intronic
1188018334 X:25129248-25129270 ATGATTACAAAAGTAATGCATGG - Intergenic
1188985354 X:36763927-36763949 ATGATTAGGCATGACATGCCTGG - Intergenic
1189348364 X:40259328-40259350 CTGATTATGAAAGCAATTCATGG + Intergenic
1190619826 X:52275292-52275314 ATGATTATGAAGTAGATTCAAGG - Intergenic
1190688689 X:52896257-52896279 ATGATTAAGAGATAAATGCAGGG + Intronic
1190697294 X:52959535-52959557 ATGATTAAGAGATAAATGCAGGG - Intronic
1191218789 X:57963202-57963224 ATAATTATAAAAGAAATACAAGG - Intergenic
1191913431 X:66176341-66176363 ATGCATATGAAAGGAATGCAAGG - Intronic
1193884380 X:86966335-86966357 ATGATTATAAAAGACAAAGAAGG + Intergenic
1193946642 X:87744842-87744864 AAGACTATGGAAGATATGCAAGG + Intergenic
1195514419 X:105756868-105756890 ATGAGAATGAAAAAAATGCAAGG - Intronic
1195751279 X:108163576-108163598 ATGAATATGACAGACATTTATGG + Intronic
1196406621 X:115369391-115369413 ATGAATATGAAAAAAAAGCATGG - Intergenic
1197952829 X:131916628-131916650 ATGATCATGAAAGACTTGGAAGG - Intergenic
1198175728 X:134152549-134152571 ATGAGTTTGAAAGACATTTAGGG - Intergenic