ID: 1122685066

View in Genome Browser
Species Human (GRCh38)
Location 14:103500120-103500142
Sequence ATGTAGAAGCAGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 994
Summary {0: 1, 1: 1, 2: 7, 3: 116, 4: 869}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122685066_1122685071 17 Left 1122685066 14:103500120-103500142 CCCTCTTCTCTCTGCTTCTACAT 0: 1
1: 1
2: 7
3: 116
4: 869
Right 1122685071 14:103500160-103500182 CCAACTGAATATGAGAGGAACGG 0: 1
1: 0
2: 1
3: 16
4: 196
1122685066_1122685069 12 Left 1122685066 14:103500120-103500142 CCCTCTTCTCTCTGCTTCTACAT 0: 1
1: 1
2: 7
3: 116
4: 869
Right 1122685069 14:103500155-103500177 GGCTTCCAACTGAATATGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 91
1122685066_1122685074 29 Left 1122685066 14:103500120-103500142 CCCTCTTCTCTCTGCTTCTACAT 0: 1
1: 1
2: 7
3: 116
4: 869
Right 1122685074 14:103500172-103500194 GAGAGGAACGGGAGATATGAGGG 0: 1
1: 0
2: 1
3: 18
4: 366
1122685066_1122685068 -9 Left 1122685066 14:103500120-103500142 CCCTCTTCTCTCTGCTTCTACAT 0: 1
1: 1
2: 7
3: 116
4: 869
Right 1122685068 14:103500134-103500156 CTTCTACATTCTGTTCATTGAGG 0: 1
1: 0
2: 2
3: 21
4: 282
1122685066_1122685073 28 Left 1122685066 14:103500120-103500142 CCCTCTTCTCTCTGCTTCTACAT 0: 1
1: 1
2: 7
3: 116
4: 869
Right 1122685073 14:103500171-103500193 TGAGAGGAACGGGAGATATGAGG 0: 1
1: 0
2: 0
3: 20
4: 244
1122685066_1122685072 18 Left 1122685066 14:103500120-103500142 CCCTCTTCTCTCTGCTTCTACAT 0: 1
1: 1
2: 7
3: 116
4: 869
Right 1122685072 14:103500161-103500183 CAACTGAATATGAGAGGAACGGG 0: 1
1: 0
2: 0
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122685066 Original CRISPR ATGTAGAAGCAGAGAGAAGA GGG (reversed) Intronic
900320823 1:2082808-2082830 ATGTAGTAGCAGGGAGAGGGTGG + Intronic
900540630 1:3200941-3200963 AGGAGGAAGGAGAGAGAAGAGGG + Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900741623 1:4333654-4333676 CTCTGGAAGCTGAGAGAAGAGGG + Intergenic
901233741 1:7656339-7656361 ATGAGGAAGCAGTGAGAAGGTGG - Intronic
901416334 1:9119413-9119435 GTGAAGACGCAGGGAGAAGATGG + Intronic
901716454 1:11158768-11158790 ATGAACAAGCAGAGGGGAGAGGG + Intronic
902416242 1:16241397-16241419 ATTTAGAGGCAGGGAGAAGCAGG + Intergenic
902531512 1:17093712-17093734 CTATACAAGCATAGAGAAGAGGG - Intronic
902599299 1:17530282-17530304 TTCTGGAACCAGAGAGAAGAGGG + Intergenic
902784274 1:18722877-18722899 AGGTGGATGCAGACAGAAGATGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
903530379 1:24025752-24025774 AAGTAGAGGCAAACAGAAGAAGG - Intergenic
903577061 1:24345573-24345595 GTGCAGATTCAGAGAGAAGAGGG + Intronic
903806984 1:26012640-26012662 ATCTGAAAGCAGAGATAAGAGGG + Intergenic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904762266 1:32814272-32814294 ATGTAGAGGCAGAGAGAAATAGG - Intronic
905295483 1:36951825-36951847 GGGAAGAAGCAGAGAGAAGGAGG + Intronic
905590281 1:39157332-39157354 TTGTAAAAACAGAGAGAAAAGGG - Intronic
906170202 1:43718589-43718611 CTGTTGAAGGAGGGAGAAGAAGG - Intronic
906663536 1:47599859-47599881 ATAAAGAAGCAAAGAGAAGCAGG + Intergenic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908022562 1:59913581-59913603 ATGTAGGTGCAGGGAGAAGGAGG - Intronic
908325605 1:63020523-63020545 GTGTAGAAGCAGAGAACAGAGGG + Intergenic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
909785086 1:79601299-79601321 AAGAAGAAGCAGAGAAAAAAGGG + Intergenic
909926529 1:81444057-81444079 TTGCAGAAGCTGAGAGAAGTAGG + Intronic
910082816 1:83361746-83361768 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
910276175 1:85451343-85451365 ATATAAAGGCAGAAAGAAGAGGG + Intronic
910475751 1:87604427-87604449 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
910537465 1:88314665-88314687 ATGCACAAGGAGAGAGAAAAGGG + Intergenic
910568870 1:88678035-88678057 ATGTGGAGGAAGAGAGAAGGAGG + Intergenic
910602489 1:89046891-89046913 ATTTGGAAGCAAAGATAAGAAGG + Intergenic
910638382 1:89434340-89434362 ATTTGGAAGCAAAGATAAGAAGG - Intergenic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
910726433 1:90344754-90344776 ATGGAGAGTGAGAGAGAAGAAGG - Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912839908 1:113030242-113030264 AAGTAAAAACAAAGAGAAGAAGG - Intergenic
913001849 1:114588533-114588555 ATGTAGAAGATGAGATAACAGGG - Intronic
913454335 1:119015615-119015637 ATGTAGAAATAGAAAGAAAATGG - Intergenic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
913663690 1:121028643-121028665 TTGTAGAAGCAAAGAGAAGTAGG - Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914015088 1:143811924-143811946 TTGTAGAAGCAAAGAGAAGTAGG - Intergenic
914162733 1:145149301-145149323 TTGTAGAAGCAAAGAGAAGTAGG + Intergenic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
914919309 1:151837025-151837047 AGGTGGAGGGAGAGAGAAGAAGG + Intergenic
916422857 1:164652548-164652570 AACTAGAAGGTGAGAGAAGAGGG + Intronic
916471471 1:165127405-165127427 CTGTAGAAGGAAAGAGAATATGG - Intergenic
916784084 1:168071100-168071122 AAGTAGAAGCAGGGAGATCAAGG - Intronic
916933324 1:169602262-169602284 ATATAGAAGTGGAGAGAGGAGGG + Intronic
916987004 1:170202370-170202392 ATGTTAAAGTAGAGAGAAAAGGG - Intergenic
917028093 1:170663754-170663776 AAACAGAAGAAGAGAGAAGAAGG - Intronic
917130617 1:171738728-171738750 ATGAAAGAGCAGAGAGTAGAGGG + Intronic
917706719 1:177642203-177642225 ATGTAGAAACACAGATAAGAAGG - Intergenic
917738785 1:177944013-177944035 ATGTAGAAACGTTGAGAAGAGGG + Intronic
918083464 1:181224972-181224994 TTATAGAAGCAGGGAGAAGTGGG + Intergenic
919039342 1:192362842-192362864 ATGTATAAGCAGTGAAAAAATGG - Intronic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919166071 1:193894984-193895006 ATGCAAAAACAGAGAGGAGAAGG - Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919427417 1:197449935-197449957 TTGAAGAACCAGAGAAAAGAGGG - Intronic
919637459 1:200016813-200016835 ATTCAGAAGCAAAGAGATGATGG + Intergenic
919919109 1:202157863-202157885 AGGTAGAAGGAGAGAAAAGGAGG - Intronic
920114465 1:203610174-203610196 ATGAAGAAGCAGAGGCCAGAGGG + Intergenic
920368649 1:205462918-205462940 ACATAGACACAGAGAGAAGATGG - Intergenic
920384931 1:205564377-205564399 ATCTGGAAGCAGAGACCAGAAGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921556475 1:216604279-216604301 ATCTAGAAGCTCAGTGAAGAGGG + Intronic
921780788 1:219160856-219160878 ATTTAGAAGAAGAGTGAAGTAGG - Intergenic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922917845 1:229272695-229272717 ATGAGGAGGCAGAGAGGAGAGGG + Intronic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
923700289 1:236293722-236293744 ATGAGGACCCAGAGAGAAGATGG + Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
924083130 1:240420277-240420299 ATGTGGAAGCTGAGAGAAGTAGG - Intronic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924217836 1:241842817-241842839 AAGCGGAAGCAGAGAGAAGCAGG - Intergenic
924761384 1:246990079-246990101 AGGGAGAAAGAGAGAGAAGAAGG + Intronic
1063054445 10:2489226-2489248 ATTTAAAAGCAAAGAGAAGGAGG + Intergenic
1063672342 10:8109430-8109452 ATGAAGACGCAGAGATAAGAAGG - Intergenic
1063733811 10:8729696-8729718 AAGTAGAAGCTGAGAGATGTAGG + Intergenic
1064237457 10:13588647-13588669 GTGTTGAAGAAGAGAGAAGGAGG - Intronic
1064299680 10:14112343-14112365 ATGGAGGAGCACAGAGGAGAGGG + Intronic
1064558008 10:16566758-16566780 ACACAGAAGGAGAGAGAAGAGGG + Intergenic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1065362125 10:24898589-24898611 GAGGAGAAGCAGAGACAAGAAGG - Intronic
1065445556 10:25794920-25794942 ATTTAGAAGAGGAGAGAAGGTGG - Intergenic
1065545233 10:26812724-26812746 GTGAAGACGCAAAGAGAAGATGG - Intronic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1067729085 10:48796188-48796210 TGGTAGCAGCAGAGAGCAGAAGG + Intronic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1068281399 10:54875332-54875354 ATGGGGAAGAAGAGAGAAGGAGG - Intronic
1068725987 10:60304067-60304089 CTATAGAAACAGAGAGTAGAAGG + Intronic
1068757499 10:60671246-60671268 ATGTAGTAGAAAAGAGAGGATGG - Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069770326 10:70894456-70894478 ATGTAGAGACACAGAGAAGGAGG - Intergenic
1070605876 10:77898304-77898326 TTGGAGAAGGAGAGAGAAAAAGG + Intronic
1070749662 10:78956439-78956461 ATCTGGAAGCTGAGGGAAGAGGG - Intergenic
1070933326 10:80275762-80275784 GTGTAGAAACACAGAGTAGAAGG - Intronic
1071400511 10:85264388-85264410 ATGCAAAAGTAGAGAGAATAGGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1072767925 10:98110839-98110861 TTGTGGAAGCACAGAGGAGAAGG + Intergenic
1073485532 10:103815957-103815979 ATATAGAAGCAGAGAAGAGAAGG + Intronic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1073689160 10:105788127-105788149 AAGGAGAAGGAGATAGAAGAAGG - Intergenic
1073707138 10:105997666-105997688 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1074125371 10:110524934-110524956 ATGAAGAAGGAGAGACAAAATGG + Intergenic
1074435155 10:113427488-113427510 ATTTATAGGCAGAGAGAAGGAGG - Intergenic
1074818969 10:117165266-117165288 ATGCAGAAGCAGTGAGCAGACGG - Intergenic
1074936334 10:118185270-118185292 ATGTGGAGGCAGAGAGTATAAGG - Intergenic
1075136115 10:119787757-119787779 ATCTAGAAGCAGACAGTAGCAGG + Intronic
1075725103 10:124606956-124606978 AGGATGAAGCAGAGAAAAGAGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1076584825 10:131539321-131539343 ATGCATAAGCAAAGAGATGAAGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078548060 11:12260694-12260716 TTTTAGAAGAAGAGAGTAGAAGG + Intronic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079666632 11:23113919-23113941 AAGTAGAGGCAGAGTGGAGAGGG + Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080499367 11:32853857-32853879 AAGAAGAAGAAAAGAGAAGAAGG + Exonic
1080653649 11:34242011-34242033 ATGCAGAAGCTGCGAGGAGATGG + Intronic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1080825957 11:35849643-35849665 GTGAAGATGCAGGGAGAAGATGG - Intergenic
1081054140 11:38386982-38387004 ATGTAGAAGCTGAGACAAAAGGG - Intergenic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1082602224 11:55172490-55172512 TTTTACAAGCTGAGAGAAGAAGG - Intergenic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1082821842 11:57549414-57549436 ATGTAGAACTAGAGACCAGAGGG + Intronic
1083469669 11:62875227-62875249 TTCTAAAGGCAGAGAGAAGATGG - Intronic
1083736708 11:64685625-64685647 AGGTAGGAGGAGTGAGAAGAAGG - Exonic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084615622 11:70233985-70234007 GTGTAGCAGGAGAGAGAAGCAGG - Intergenic
1085027265 11:73243512-73243534 ATCCAGAAGCAGAGGTAAGATGG + Intergenic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1086450192 11:86907911-86907933 TTGTAGGAGCAGAGAATAGATGG - Intronic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087603654 11:100347371-100347393 TTGTGGAAACAGAGAAAAGAAGG - Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087675159 11:101153186-101153208 TTGTGGAAGAATAGAGAAGAAGG - Intergenic
1087886021 11:103483641-103483663 AGATAAAAGCAGAGACAAGAAGG + Intergenic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088556934 11:111071306-111071328 ATGGACATACAGAGAGAAGATGG + Intergenic
1088982714 11:114878091-114878113 ATTAATAAGCAGAGAGCAGAAGG + Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1089531664 11:119133909-119133931 ATGTAGAAGAAAAGGCAAGAGGG - Intronic
1090180883 11:124698491-124698513 AGGTGGAAGCTGGGAGAAGAAGG - Intergenic
1090382179 11:126335182-126335204 AGGCAGAAGCAGAGAGCAGGAGG + Intronic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1090648856 11:128789110-128789132 ATGTTGAAGCAAAGGGAAGGAGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091471378 12:731058-731080 ATGCAGAAGTAGAGAGCAGCTGG + Intergenic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092047214 12:5440376-5440398 ATCTAGAAACAGAGGGAAGGGGG - Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092404646 12:8210658-8210680 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1093407803 12:18826345-18826367 ACATAGAAGCAGAGAGTAGCAGG - Intergenic
1094135900 12:27125773-27125795 ATGTAGATCCAGAGAGATAAGGG + Intergenic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1094474964 12:30833765-30833787 GTGGAGAAGGAGAGAAAAGAAGG + Intergenic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095328910 12:40933101-40933123 AGGGAGAAGGAAAGAGAAGAAGG - Intronic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1095828249 12:46553457-46553479 CTATAGATGCAGAAAGAAGAAGG + Intergenic
1097008543 12:55936249-55936271 AGGTAGAGGCATAGGGAAGAGGG + Intronic
1098232474 12:68386546-68386568 TGGTGGAAGAAGAGAGAAGATGG - Intergenic
1098346844 12:69514418-69514440 GAGCAGAAGCAGAGAGCAGAAGG - Intronic
1098892038 12:76019056-76019078 GAGGAGAAGGAGAGAGAAGAGGG + Intergenic
1099010079 12:77281399-77281421 ATCTAGAAGCAGAAAGAATGTGG + Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099160160 12:79231155-79231177 ATTTAGAAGCAGAAACCAGAGGG + Intronic
1099507410 12:83496577-83496599 AAGTAGAATCAGAGAATAGATGG - Intergenic
1099539850 12:83894235-83894257 ATAGAGAAAGAGAGAGAAGAGGG - Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099709100 12:86197041-86197063 ATGTAGAAGCACAGTGTTGAAGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100908235 12:99326497-99326519 ATTCAAAAACAGAGAGAAGAAGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102573594 12:113842471-113842493 ATGTGGAACCAGAGAAATGAAGG - Intronic
1102854642 12:116282772-116282794 ATGTAATGGCAGAGAGAAAATGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103083148 12:118041314-118041336 ATGAGGATGCAGAGAGAAGGTGG + Intronic
1103910902 12:124351578-124351600 GTGTTCAAGCAGAGAGGAGATGG + Intronic
1103931955 12:124455490-124455512 AGGCAGAAGCAGGGAGGAGATGG - Intronic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1104270549 12:127278939-127278961 ATGCAGGAGCAGAGAGAATGAGG - Intergenic
1104722591 12:131053244-131053266 AAGTGGAAGCAGACAGCAGAGGG - Intronic
1105674380 13:22654576-22654598 ATATAGTTACAGAGAGAAGATGG + Intergenic
1106289906 13:28350969-28350991 ATGGAGAAACAGAGAGACGGTGG - Intronic
1106658279 13:31770922-31770944 ATGTAGAACTAAAGAGAAGGTGG + Intronic
1106742817 13:32665097-32665119 ATGTAGAAGCTGAGAGAGAGTGG + Intronic
1106777983 13:33026892-33026914 ATCAAGAAGCAGAGAGAAGCTGG - Intronic
1107266703 13:38564142-38564164 GTGAAGAGGCAGAGAGAACACGG - Intergenic
1107568422 13:41630425-41630447 GTGTTCAAGCAGAAAGAAGAAGG - Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1109077348 13:57853183-57853205 ATGCAGCAGCAAAGAGGAGAGGG + Intergenic
1109289800 13:60460005-60460027 ATGTAAAAGGAGGGAGAAGTGGG + Intronic
1109446862 13:62450908-62450930 ATCAAGAAGCGTAGAGAAGAAGG - Intergenic
1109551401 13:63906072-63906094 ATGCAGAAGCACAGCGAACAGGG + Intergenic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110514348 13:76392237-76392259 AAATATAAGCAGAGAGTAGAAGG + Intergenic
1112142499 13:96660908-96660930 AGGTAGAAGAAGTGGGAAGAAGG + Intronic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112385881 13:98939295-98939317 ACCTAAAATCAGAGAGAAGAAGG + Intronic
1112748342 13:102553073-102553095 ATGGTCCAGCAGAGAGAAGACGG - Intergenic
1112842974 13:103602215-103602237 ACGAAGAAGCAAAGAGAAAAAGG + Intergenic
1113067253 13:106384869-106384891 ATGTGGGATCATAGAGAAGAAGG + Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1113222025 13:108115870-108115892 AACCAGAAGCAGAGATAAGATGG + Intergenic
1113257270 13:108520132-108520154 ACATAGAAGGAGAGAGAAAAAGG - Intergenic
1113587637 13:111476215-111476237 ATGTGGACACAGAGAGAAGGTGG + Intergenic
1114401749 14:22416486-22416508 ATGTAGAGGCAGAGAAAAGCTGG - Intergenic
1114601655 14:23960206-23960228 AGATAGAAGCAGAGAGAACTAGG - Intronic
1114605823 14:23995331-23995353 AGATAGAAGCAGAGAGAACTAGG - Intronic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1116081870 14:40184926-40184948 TCATAGAAGCAGAGAGTAGAGGG - Intergenic
1116419496 14:44716369-44716391 ATATATAAGCAGAGACCAGAGGG - Intergenic
1116683962 14:48013989-48014011 GTATAGAAGCAGAGAGTAGAAGG + Intergenic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1117014616 14:51505904-51505926 AAGTAGAAACAGGGAGATGAAGG - Intronic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117392566 14:55276083-55276105 AATTAGAAGCATAGAAAAGAGGG + Intronic
1117440179 14:55752382-55752404 ATTTAGGAGCACTGAGAAGAGGG - Intergenic
1117456443 14:55901948-55901970 ATGAAGAAACTGGGAGAAGAGGG + Intergenic
1118071368 14:62249878-62249900 ATGAAGTCACAGAGAGAAGATGG - Intergenic
1118147527 14:63156792-63156814 TTGTAGAAACAGAGAGTAGAAGG - Intergenic
1118588150 14:67376600-67376622 AGGTAGAAGGAGAGTCAAGAAGG - Intronic
1119765285 14:77183849-77183871 ATATAGCACCAGAGAGGAGAGGG + Intronic
1120105105 14:80485018-80485040 AGGTAGCATCAGACAGAAGACGG + Intronic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1121017448 14:90557124-90557146 AGGTAGAAGCAGAGGGCAGATGG - Intronic
1121234653 14:92383443-92383465 ATCTTGAGGCAGAGAGAGGAAGG - Intronic
1121782619 14:96631681-96631703 ATGTAAAAGCAGAAAGGTGATGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122611724 14:102988581-102988603 GTGCAGAGGCAGAGAGAAAATGG + Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122877074 14:104672757-104672779 ATGTAGAGAGACAGAGAAGAGGG - Intergenic
1202895777 14_GL000194v1_random:8861-8883 AGGTAGAAGCACAGAAAAAAGGG - Intergenic
1124153338 15:27202076-27202098 AGATAGAAGCAGAGAGGAGATGG - Intronic
1124918267 15:33998007-33998029 AAGTGGAAGGAGAGAGCAGAAGG - Intronic
1125347591 15:38733704-38733726 ATGAAGACACAGTGAGAAGATGG - Intergenic
1125542020 15:40475075-40475097 AGGTAGGGGTAGAGAGAAGAAGG + Intergenic
1125890078 15:43259073-43259095 AGGTAGAAAGAGAGGGAAGATGG + Intronic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1127463197 15:59218811-59218833 GTGCAGATGCAGAGAGGAGAAGG + Intronic
1127819195 15:62640361-62640383 GGCTAGAGGCAGAGAGAAGAGGG + Exonic
1128073583 15:64812420-64812442 AAGGAGAGGCAGAGAGAAGGAGG + Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128159700 15:65415507-65415529 ACGTAGACACAGAGAGAAGACGG + Intronic
1128692697 15:69737329-69737351 TTTTAGAAGCAGAGATTAGAGGG + Intergenic
1128748805 15:70133872-70133894 ATGGAGAAGCAAAGGGCAGATGG - Intergenic
1129312400 15:74721843-74721865 TTGCAGAGGCAGAGAGAAGCTGG - Intronic
1129921887 15:79326446-79326468 TTATAGAACCAGAGAGAACATGG - Intronic
1131139818 15:89968096-89968118 AGGGAGAGGAAGAGAGAAGAAGG + Intergenic
1131235013 15:90688706-90688728 ATGTAGACAAAGGGAGAAGATGG + Intergenic
1131437665 15:92436037-92436059 AGATAGAAGCACAGAGGAGAGGG - Intronic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132953869 16:2580709-2580731 TGGAAGCAGCAGAGAGAAGAGGG - Intronic
1132960476 16:2619454-2619476 TGGAAGCAGCAGAGAGAAGAGGG + Intergenic
1133070362 16:3242773-3242795 AGACAGAAGCAGAGAGAACAAGG + Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133392770 16:5422830-5422852 AGGGAGGAGCAGAGAGAAGGAGG + Intergenic
1133418666 16:5626314-5626336 ATGAAGACACAGGGAGAAGACGG - Intergenic
1133465480 16:6023008-6023030 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1135149113 16:19989930-19989952 ATATAGAGGCAGAGAGGAGCTGG - Intergenic
1135876955 16:26211042-26211064 ATGTAGCAACAGAGAAAAGTGGG + Intergenic
1135928930 16:26720134-26720156 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1135932241 16:26747907-26747929 ATGTGGGAGCAGAGAGGAGGGGG - Intergenic
1136382202 16:29900919-29900941 AGGTAGAAGGAGAGAGAAAGGGG + Exonic
1137756887 16:50909405-50909427 ATGAGGAAGCAGAGAAGAGAAGG - Intergenic
1137819414 16:51429443-51429465 ATTTAGAAGATGAGAGAAGATGG + Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138564306 16:57821643-57821665 ATGTACCAGTAGAGATAAGAAGG - Intronic
1138639091 16:58368583-58368605 TTATAGAGGCAGAGAGGAGATGG - Intronic
1138715820 16:59021183-59021205 AGGTAGAGTCAGAGATAAGAAGG + Intergenic
1138925790 16:61589863-61589885 ATGTAGAACCAGATAGAACTAGG + Intergenic
1139208689 16:65054765-65054787 AGGTAGAAGCCTAGAGATGAAGG - Intronic
1139278998 16:65753780-65753802 ATCTAGAAGCAGAGCGATAAAGG + Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1139642393 16:68301819-68301841 ATATTAAAGAAGAGAGAAGAAGG - Exonic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1140737695 16:77912867-77912889 ATGAGGAAGCAGTGAGAAGACGG - Intronic
1141278768 16:82611744-82611766 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141458866 16:84164395-84164417 ATGAAGAAGCAGAGCACAGAGGG - Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143818378 17:9539246-9539268 ATGAGGAAGAAGAGAAAAGAGGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144163986 17:12589848-12589870 AGGTGCAAGCAGAGAGAAGCTGG + Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144605700 17:16663604-16663626 ATGCAGCAGCAGAGAGGATAGGG - Intergenic
1144649820 17:17000271-17000293 ATGTGGAGGCAGAGAGGATAGGG - Intergenic
1144968567 17:19093115-19093137 ATGTAGAAGTGCAGAGGAGAAGG + Exonic
1145080819 17:19892960-19892982 AAGTAGAGACACAGAGAAGAGGG + Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145095823 17:20025165-20025187 GTGAAGACGCAGGGAGAAGATGG + Intronic
1145263472 17:21368172-21368194 ATTAAAAAGCTGAGAGAAGAGGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145916295 17:28576004-28576026 CTCTAGAAGCTGAGAGAAGAGGG - Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146543216 17:33715867-33715889 ATGTAGATACAGAGAGAAAGTGG + Intronic
1146942837 17:36855604-36855626 ACCTGGAACCAGAGAGAAGAGGG + Intergenic
1147337417 17:39735951-39735973 AAGTAGAAGCACAGAGGAGAGGG - Intergenic
1147526590 17:41230404-41230426 AAGAGGAAGGAGAGAGAAGAAGG + Intronic
1147705064 17:42420737-42420759 ATGGAGATTCTGAGAGAAGAGGG - Intronic
1147800696 17:43084616-43084638 GTGTAGCAGGAGAAAGAAGATGG - Intronic
1148618254 17:49015637-49015659 ATGTGGAAGCACAGAGAATGGGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1150170704 17:62991106-62991128 ATGTGGAATCAGAGAGCAAAGGG + Intergenic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150662929 17:67101132-67101154 AAATAGAAGAAGAGAGAAAAAGG + Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153223134 18:2879114-2879136 ATGTCGGGGGAGAGAGAAGATGG + Intronic
1153296382 18:3550640-3550662 ATGAAGACACAGGGAGAAGATGG + Intronic
1153379475 18:4421285-4421307 AGGTAGATGCATAGAGGAGAAGG - Intronic
1153512804 18:5873834-5873856 ATGAAGACACAGGGAGAAGATGG + Intergenic
1153738435 18:8097352-8097374 AGGTAGAAGTAGAGATGAGATGG - Intronic
1153827858 18:8893341-8893363 ATGAAGATACAAAGAGAAGATGG - Intergenic
1154236785 18:12613459-12613481 CTAAAGGAGCAGAGAGAAGAAGG - Intronic
1154408607 18:14121135-14121157 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1155343708 18:24838118-24838140 ATGGAGAGGAAGAGAGAAGGTGG + Intergenic
1155566306 18:27138407-27138429 ATGTAGAAGCTGGCAGGAGAAGG - Intronic
1155705695 18:28808870-28808892 ATGTGGAAGGAGAGAAGAGAAGG - Intergenic
1156111726 18:33735668-33735690 AGGCAAAAGCAGAGGGAAGAAGG - Intronic
1156129379 18:33951950-33951972 ATGTAGAACCAGACAGATTAGGG - Intronic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1157465972 18:47945375-47945397 AGATGGAAGCAGAGACAAGATGG + Intergenic
1158317943 18:56232175-56232197 AAGGAAAAGAAGAGAGAAGAAGG + Intergenic
1158355051 18:56608698-56608720 ATGCAGAAGCAGATATGAGAAGG + Intronic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159360510 18:67395779-67395801 ACGAAGAAAAAGAGAGAAGAAGG - Intergenic
1159451325 18:68605788-68605810 TCATAGAAGCAGAGAGGAGAAGG - Intergenic
1159482073 18:69002297-69002319 TTGTAGAGGCAGAAAAAAGAGGG + Intronic
1159741067 18:72171369-72171391 ATGTAGTATCAGTGAGAAAAGGG + Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159941708 18:74413365-74413387 ATGCCTATGCAGAGAGAAGATGG - Intergenic
1160064552 18:75562561-75562583 ATTGAGAGGCAGAGAAAAGAAGG + Intergenic
1160072453 18:75640529-75640551 AAGTGGAAGGAAAGAGAAGAAGG - Intergenic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161412069 19:4122616-4122638 ATGTCCTTGCAGAGAGAAGATGG - Intronic
1162147532 19:8621850-8621872 GTGAAGACGCAGAGAGAAGGTGG + Intergenic
1162470608 19:10870618-10870640 AGGGGGATGCAGAGAGAAGACGG + Intergenic
1162813960 19:13181986-13182008 ATTTAGAATCAGGGAGAAGGAGG - Intergenic
1163235763 19:16029580-16029602 AGGTGGAAGCTGAGAGAAGCTGG - Intergenic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1165189129 19:34047739-34047761 CTATAGAAGCAGTGAGAACATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166715193 19:44962505-44962527 ATGAAGACACAGGGAGAAGACGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167197004 19:48036473-48036495 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1167798391 19:51725403-51725425 AGGTAAAAGCAGAGAGAGAATGG - Intergenic
1168503343 19:56912199-56912221 CTCTAGAAGCAGAAAGAAGGAGG - Intergenic
1168517254 19:57018061-57018083 ATGTAGAAGAGGAGATGAGATGG - Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925116439 2:1382385-1382407 CTATGGAAGCAGAGAGAAGGGGG + Intronic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925860070 2:8166080-8166102 AAGCAGACGCAGAGAGGAGAGGG - Intergenic
926531610 2:14054009-14054031 GTGTAAATGCAGAGAAAAGAAGG - Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
927003218 2:18821442-18821464 CTCTAGAAGGAGAGAGGAGAAGG + Intergenic
927013585 2:18932153-18932175 ATTGAAAAGCAGAGAAAAGAAGG - Intergenic
927257799 2:21055538-21055560 GTATAGATGCAGGGAGAAGATGG - Intergenic
928055908 2:28054337-28054359 ATTTAAAATAAGAGAGAAGATGG - Intronic
928617110 2:33051776-33051798 ATGTAGAAGCAGACATAAAGTGG - Intronic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929578997 2:43070044-43070066 CTGGAGAAGCTGGGAGAAGAGGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930542555 2:52725027-52725049 GTGTTGAAGCAGAGAGAAGGAGG - Intergenic
930583316 2:53239409-53239431 ATGTAGGGGCAGAAAGAATAAGG - Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931844036 2:66184258-66184280 ATGCAGAATCAGAGATAAAAGGG + Intergenic
931868012 2:66432704-66432726 AGGGAGAAACAGAGAGAAAAAGG + Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
932938189 2:76131030-76131052 ATGAACAAGATGAGAGAAGATGG - Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933480560 2:82851775-82851797 ATGCAGCAGCTGAGAGAAAAAGG + Intergenic
933949191 2:87313793-87313815 GTGTGGAAACAGAGAGAAGGCGG - Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934982280 2:98852927-98852949 AGGGAAAAGGAGAGAGAAGAAGG + Intronic
935237749 2:101152192-101152214 TTGTGGAAGCAGAGACAAGGTGG + Intronic
935468204 2:103425038-103425060 GTGAAGAAACACAGAGAAGATGG + Intergenic
935829012 2:106979780-106979802 CTATAGAAGCAAAGAGAGGAGGG + Intergenic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936274708 2:111084551-111084573 ATGTTGCTTCAGAGAGAAGATGG - Intronic
937198806 2:120183444-120183466 ATGTAGCTGCAGAGATAAGGAGG - Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937468999 2:122159203-122159225 AAGAAGAGGCAGAGAGGAGAGGG + Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937617856 2:123947201-123947223 AAGTATAAGGAGAGAAAAGAAGG + Intergenic
937688917 2:124731604-124731626 ATGCAGAGACAGAGAGAAAAAGG + Intronic
937740841 2:125351335-125351357 ACTGAGAAGCATAGAGAAGAGGG + Intergenic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
938594745 2:132776590-132776612 ATGAAGAAGCAGCAAGAAAATGG + Intronic
938946916 2:136220953-136220975 AAGTAGAGGGAGAGAGATGAAGG - Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939173960 2:138728229-138728251 ATGAAGACACAGGGAGAAGATGG + Intronic
939465727 2:142553375-142553397 ATATTGAAGCAGAAAGAATATGG + Intergenic
939596925 2:144136683-144136705 ATGGAGAGGCAGAGAAAAAAGGG - Intronic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
940896877 2:159089449-159089471 ATTGAGAAGTAAAGAGAAGAGGG - Intronic
941326910 2:164126944-164126966 ATGTAGAAGTAGAGAAAAACTGG + Intergenic
941759669 2:169227967-169227989 GTGGAGCAGCTGAGAGAAGAAGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942276170 2:174325673-174325695 ATGTAGTAATAGAGAGAAAAAGG + Intergenic
942411854 2:175717726-175717748 ATTGAGAAGTTGAGAGAAGAAGG + Intergenic
942554738 2:177160158-177160180 ATGTAGATTTAGAGATAAGATGG - Intergenic
942605864 2:177690008-177690030 ATGTACAAGCAGATAGGACACGG - Intronic
943222609 2:185130222-185130244 ATGTAGAACCCAAGAGAATAGGG + Intergenic
943493026 2:188580710-188580732 TTCTGGAAGCAGAGAGAAAAAGG - Intronic
943699679 2:190976057-190976079 ATGCAGAAACAACGAGAAGAAGG + Intronic
943877960 2:193098114-193098136 ATATAGGAGCAGAGAGTAGATGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
945059922 2:205899946-205899968 GTATAGAAGCAGAGAGATGAGGG + Intergenic
945447842 2:209959422-209959444 ATGTAGCAGCTGTGAGAAGAGGG - Intronic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946739690 2:222789579-222789601 AAGTAGAAGAAGAGAGCAAAAGG + Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948237783 2:236403318-236403340 AGAGAGAGGCAGAGAGAAGAGGG + Intronic
948436739 2:237958852-237958874 GTGAAGAAACAGGGAGAAGATGG - Intergenic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948703436 2:239775045-239775067 ACATAGAAGCAGAGGGAAGGGGG + Intronic
948912831 2:241013266-241013288 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1168881290 20:1208372-1208394 ATGTAGAGGCAGAGTGGAGGGGG + Intergenic
1169010082 20:2243236-2243258 ATGTATAGGAAGGGAGAAGAAGG - Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169254041 20:4083711-4083733 ATCTGAAAGCAGAGAGAAGAAGG - Intergenic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169928505 20:10807727-10807749 ATGATGAAGGAGAGAGAAGTTGG - Intergenic
1169928630 20:10808502-10808524 ATGATGAAGGAGAGAGAAGTTGG + Intergenic
1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG + Intergenic
1170721430 20:18883233-18883255 ATATAAAAGCAGAGAGGAAAAGG - Intergenic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171336583 20:24390704-24390726 AGGTAGAATCAGAGGGAAGGTGG - Intergenic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172361624 20:34316624-34316646 CCGTAGGAGCAGAGAGAAGGAGG + Intergenic
1172394167 20:34587678-34587700 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1172865108 20:38089903-38089925 TTGTACCAGCAGAAAGAAGAGGG + Exonic
1172886398 20:38234008-38234030 ATGAAGATACAGGGAGAAGATGG + Intronic
1173027065 20:39317864-39317886 ATGTATAAAGAGAGAGAAAATGG - Intergenic
1173095005 20:40017708-40017730 TTGCAGAAACAGAGACAAGAGGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174101074 20:48126596-48126618 CTGGAGACGCAGGGAGAAGATGG - Intergenic
1174161192 20:48551649-48551671 ATATGGAAGCAGAGAGAGCAAGG - Intergenic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174533636 20:51234095-51234117 ACGAAGACACAGAGAGAAGACGG - Intergenic
1174662534 20:52226673-52226695 AAGAAGAAGGAGAGAGAAGGTGG - Intergenic
1174857213 20:54057767-54057789 ATGAAGATGCAGGGAGGAGATGG + Intronic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1175617270 20:60411337-60411359 GTGTGGATGCAGAGAGGAGATGG - Intergenic
1176093091 20:63327564-63327586 AGGTGGAAGAAGACAGAAGACGG + Intronic
1176615467 21:9024923-9024945 AGGTAGAAGCACAGAAAAAAGGG - Intergenic
1177345519 21:19863536-19863558 ATGAAGAGGCAGAGATTAGAAGG + Intergenic
1178039043 21:28619092-28619114 ATGAAGACACAGGGAGAAGACGG + Intergenic
1178125968 21:29516120-29516142 TTGTAGAAGGGAAGAGAAGAAGG + Intronic
1178188376 21:30251347-30251369 ATATAGAATCACAGACAAGAAGG + Intergenic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179367687 21:40773401-40773423 ATGAAGACACAGGGAGAAGAAGG - Intronic
1179462144 21:41543490-41543512 AAGTAGAAGAGGAGAGAAAAAGG + Intergenic
1179560268 21:42211461-42211483 AGGTAGAGACAGAGAGAGGAAGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180057916 21:45368539-45368561 ACTTAGAAGAGGAGAGAAGAGGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181497771 22:23297534-23297556 ATGGAGAGGGAGAGAGAAGTGGG - Intronic
1181570468 22:23765514-23765536 ATGCAGAGGTAGAGACAAGAAGG + Intronic
1181633060 22:24161524-24161546 AAGTAGCAGCTGAGAGAAGCAGG - Intronic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1182184109 22:28384130-28384152 ATGTATAAGCAGAGACCTGAAGG - Intronic
1182243090 22:28932935-28932957 AGGTAGAAGAAGGGAGAGGAAGG - Intronic
1182722278 22:32412986-32413008 ATGACGAAACAGAGATAAGAGGG - Intergenic
1182977540 22:34637417-34637439 AGGTAGAAGCAGATAGCTGATGG - Intergenic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
949367899 3:3302786-3302808 AGGCAGCAGGAGAGAGAAGAAGG - Intergenic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
950427865 3:12934408-12934430 GTCTAGAAGAAGAGAGAACAGGG + Intronic
950576522 3:13835334-13835356 AGGTAGAACCAGAGAGAGAACGG + Intronic
951530673 3:23695323-23695345 ATGTACAAAGAGAGAGAAAAGGG - Intergenic
951735105 3:25854888-25854910 ATGAAGAAGCTGAGAGTAGGAGG + Intergenic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
951946985 3:28149535-28149557 ATGTGCAGGCAGAGAGCAGACGG + Intergenic
952344475 3:32471027-32471049 AAGAAGAAGAAGATAGAAGAAGG + Intronic
952553844 3:34509442-34509464 ATGAAGAAGAAGAGAGAAAGAGG - Intergenic
953118764 3:40018685-40018707 AGGTAGAAGCTGTGAGAGGAAGG - Intronic
953189631 3:40671851-40671873 GCGTAGAAGCAGAGAGTATATGG + Intergenic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
956413584 3:69003839-69003861 ATGTAAAAGCATACAGAAAAAGG - Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956777126 3:72574666-72574688 ATCTATAAACAGAGAGAAGAGGG + Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957440860 3:80245454-80245476 ACATAGAACCAGAGAGAATAAGG - Intergenic
957482135 3:80811924-80811946 ATGAATAATCTGAGAGAAGAAGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
958002906 3:87773756-87773778 TTGTATAAGGTGAGAGAAGAGGG + Intergenic
958155788 3:89753872-89753894 ATATAAAAGCAAAGAGAAAATGG + Intergenic
959487076 3:106939096-106939118 ATCTAGAAGCAAAGATGAGATGG - Intergenic
959560708 3:107777330-107777352 GTTGAGAAGCAGAGATAAGAGGG - Intronic
960184603 3:114623494-114623516 ATGCAGAAGAATAAAGAAGAGGG + Intronic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
960757061 3:121026588-121026610 ATGTAGTTTCAGAGAAAAGATGG + Intronic
961381635 3:126499527-126499549 ATGTAAAAGAAGAGAAAAGCAGG + Intronic
961902395 3:130225657-130225679 ATAAAGAAACAGAGATAAGAAGG + Intergenic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
962417168 3:135193572-135193594 AAGCAGAAGCTGAGAGCAGAGGG + Intronic
962426369 3:135272175-135272197 ACGTAGGAGCTCAGAGAAGAGGG + Intergenic
963725355 3:148914136-148914158 ATGCACAAACAGAGAAAAGAAGG + Intergenic
963738417 3:149048873-149048895 ACTTAGAATCAGAAAGAAGATGG - Exonic
964430312 3:156598741-156598763 ATGAAGAAGCAGCGAGAAAATGG + Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964674190 3:159259069-159259091 ATCTAGAAGAGGAGAGGAGAGGG - Intronic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965450760 3:168834801-168834823 GTGAAGAAGCTGGGAGAAGAGGG - Intergenic
965632107 3:170743625-170743647 TCATAGAAGCAGAGAGTAGACGG - Intronic
965752816 3:171994298-171994320 AGAGAGAAGCAGAGAGAATAAGG + Intergenic
965924465 3:173959793-173959815 ATGTAGGAGCATAGAAAATATGG - Intronic
966052331 3:175635797-175635819 CTGTAGAAGTACAGAGACGAAGG + Intronic
966109763 3:176385283-176385305 ATGTAGCAGCAGAGAACACATGG - Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966244325 3:177789799-177789821 CTATAAAAGCAGAGAGGAGAGGG + Intergenic
966474584 3:180329178-180329200 ATGTAGAGGCAGTGTGGAGAGGG - Intergenic
966515119 3:180811420-180811442 ATGTAGGAACAAAGAGAACATGG - Intronic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966640810 3:182187637-182187659 ATGAAGTACCAGAGAGGAGAAGG - Intergenic
967223067 3:187265525-187265547 TTTTAGAAGCAGAGAAGAGAAGG + Intronic
967756256 3:193173155-193173177 AATTAGAAAAAGAGAGAAGATGG + Intergenic
967928144 3:194668997-194669019 TCATAGAAGCAGAGAGAAAATGG + Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968413469 4:408380-408402 AGGTAGAGACAAAGAGAAGAGGG + Intergenic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969761474 4:9187363-9187385 ATTTAGAAGTAGAGTAAAGAGGG - Intergenic
969782817 4:9423001-9423023 ATGTAGAATCAAACAGAAAAGGG + Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
970374993 4:15448041-15448063 ATGAAGACACAGTGAGAAGATGG + Intergenic
970382668 4:15523729-15523751 AAGAAGAATCAGAGAAAAGAGGG - Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971873031 4:32268999-32269021 AAGTAGAAGTAGAGAGGAAAAGG - Intergenic
972399400 4:38686690-38686712 TTGTATAAGCAGGGACAAGAAGG + Intronic
972866631 4:43241263-43241285 ATGCAGAAGCAGCCAGATGATGG - Intergenic
972985724 4:44762201-44762223 GTTTAATAGCAGAGAGAAGATGG + Intergenic
973754900 4:54064769-54064791 GGGTAGAAGCAGAGGAAAGACGG - Intronic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974088863 4:57289642-57289664 GTGGAAACGCAGAGAGAAGATGG + Intergenic
974092508 4:57326814-57326836 ATGTATAGACAGAGAGAAAATGG - Intergenic
974343170 4:60640263-60640285 ACATAGACACAGAGAGAAGAAGG - Intergenic
975058609 4:69968275-69968297 ATATAGAAACAAAGAGTAGAAGG + Intergenic
975209113 4:71678444-71678466 ATCTGGAAGGAGAGAGAAAATGG + Intergenic
975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG + Intronic
975648818 4:76571991-76572013 TGGAGGAAGCAGAGAGAAGATGG - Intronic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976026029 4:80688700-80688722 TTTGAGAAGCTGAGAGAAGAAGG + Intronic
976087740 4:81423413-81423435 ATGTAGAATCTTAGAGAAGCAGG + Intergenic
976488709 4:85641518-85641540 ATGAAGACCCGGAGAGAAGATGG - Intronic
976621798 4:87135885-87135907 ATGCAGAAGCAGAGATGAGGAGG + Exonic
976747385 4:88417488-88417510 ATGAAGCAGCTGAGAGATGATGG - Exonic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
977400638 4:96527115-96527137 ATTTAAGAACAGAGAGAAGAAGG + Intergenic
977441290 4:97071033-97071055 ATGAAGATACAGGGAGAAGATGG + Intergenic
977851674 4:101837925-101837947 AGGGAGAGGGAGAGAGAAGAGGG - Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
978489699 4:109299903-109299925 TAGTAGAAGGACAGAGAAGAAGG - Intronic
978582609 4:110247356-110247378 ATGTAGACACAGAGAGGAAAGGG - Intergenic
978877557 4:113660122-113660144 ATCTAGAAGCAGTGAGAAAAGGG - Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979478911 4:121191165-121191187 ATGAAGAAGCAGAGACTATAAGG + Intronic
979831274 4:125307454-125307476 ATGTGAAAGCTGAGAGAAAAAGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980084593 4:128378226-128378248 AGGTGGCAGGAGAGAGAAGAGGG + Intergenic
980681083 4:136161099-136161121 AACTTGAAGCAGAGAGCAGAAGG - Intergenic
980714627 4:136613920-136613942 TTGTAGAAGCAGAGATTAGCCGG - Intergenic
980773610 4:137411151-137411173 ATTGAGAAGCAGAGAGAACTTGG - Intergenic
981010747 4:139922401-139922423 ACATACAGGCAGAGAGAAGAAGG + Intronic
981398033 4:144277572-144277594 ATTTAGAAGAAGAGATTAGATGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981872950 4:149508248-149508270 CTAGAGAAGCTGAGAGAAGAGGG + Intergenic
982089335 4:151866903-151866925 GAGAAGAGGCAGAGAGAAGACGG - Intergenic
982097620 4:151937040-151937062 ATGATGAAGCAGAGAGATGCAGG - Intergenic
982216620 4:153088001-153088023 ATGTAGAAGCAGCACCAAGAGGG + Intergenic
982318986 4:154059560-154059582 AGGTAAAAGCAAAGAGAGGATGG - Intergenic
982811687 4:159833417-159833439 ATTTAGAACCAGTGACAAGATGG - Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983768156 4:171512725-171512747 ATACAGAGGCAGAGGGAAGAGGG - Intergenic
983812936 4:172086989-172087011 AGGTAGCAGGAGACAGAAGAGGG - Intronic
984448643 4:179870503-179870525 ATGAAAAAGTAGAGAGAAAAAGG - Intergenic
984489509 4:180415280-180415302 AGGTAGAAGCAGTTAGAAAAGGG + Intergenic
984535534 4:180970070-180970092 AAGTAGCAGCAAAAAGAAGAGGG - Intergenic
984720151 4:182963986-182964008 TTAAAGAAGCTGAGAGAAGAAGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985209665 4:187579115-187579137 ATAAATAAGAAGAGAGAAGAAGG + Intergenic
985987592 5:3529689-3529711 AGGGAGAAGGAGAGAAAAGAGGG - Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986450121 5:7854905-7854927 ATATAAAAGCAGGCAGAAGAAGG - Intronic
986991206 5:13554804-13554826 ATGTAGAGTCAGAGAGATGGAGG + Intergenic
987074518 5:14368314-14368336 ATGAACAAGCAGAGAAAAGGTGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
988422815 5:31026889-31026911 ATGAAGACACAGGGAGAAGATGG + Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
989603377 5:43220849-43220871 TTGAAGAAGCCGAGAGAAGAAGG + Intronic
989648642 5:43665089-43665111 ATGTAGAGGGACAGAGGAGAGGG - Intronic
989734507 5:44687765-44687787 AAGAGGAAGCAGAGAGAAGTGGG + Intergenic
990120950 5:52450734-52450756 ATGTAGCTGCAGAGAGAAAAGGG - Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
991445824 5:66698924-66698946 AAGTGGAAGCAGAGAGACCAAGG - Intronic
992246866 5:74834895-74834917 AGCTGGAAGCAGAAAGAAGATGG - Intronic
992288108 5:75256122-75256144 ATGTCGAAGAAGAGCCAAGATGG - Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992787523 5:80184241-80184263 ATGGAGTAGAAGAGAGAAGGTGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993223289 5:85131936-85131958 ATGCAGATGCAGGGGGAAGAAGG - Intergenic
993700349 5:91111927-91111949 ATATAGAAGCTGAGACAAGGAGG + Intronic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994255304 5:97586654-97586676 ATGTAGAAGAACAAAGAAGTTGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994687226 5:102970423-102970445 TTGTAAAGGAAGAGAGAAGATGG + Intronic
994905715 5:105839220-105839242 AAGTAGGAGCTGTGAGAAGAGGG - Intergenic
996058610 5:119008144-119008166 ATGAAGAAACAATGAGAAGATGG - Intergenic
996151046 5:120035215-120035237 ATGTGGAAACAGAGAGATGGGGG - Intergenic
996272619 5:121625193-121625215 ATGCAGACTTAGAGAGAAGAGGG + Intergenic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
996590897 5:125146941-125146963 AGGAAGAAGCAGGGAGAAGCAGG - Intergenic
996608081 5:125347180-125347202 ATGTTGCAGCAAAAAGAAGAAGG + Intergenic
997341038 5:133144780-133144802 ATGTAAGAGCAGAGAGGACAGGG + Intergenic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
997827937 5:137124311-137124333 GGGGAGAAGCACAGAGAAGAGGG - Intronic
997893957 5:137699327-137699349 ATGGAGTAACAGTGAGAAGAAGG + Intronic
998303441 5:141049440-141049462 ATGTAGAAGGTGAGAGGAAAGGG - Intergenic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
998769381 5:145524525-145524547 ATCCAGAAGCAGAGCAAAGAGGG + Intronic
998908183 5:146929140-146929162 ATGTGGAAGAAGAGAGAGGTAGG - Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999626695 5:153528785-153528807 ACGTGGAGGAAGAGAGAAGAAGG - Intronic
1000102187 5:158026623-158026645 ATGGAGCAGGAGGGAGAAGAGGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000913057 5:167045500-167045522 AAGGTGAAGGAGAGAGAAGAGGG - Intergenic
1001140104 5:169137283-169137305 ATGTAGATAGAAAGAGAAGAGGG - Intronic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002655536 5:180743754-180743776 CTGTAGATGCTAAGAGAAGAGGG - Intergenic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003384987 6:5659154-5659176 GTGAACAAGCAGAGAAAAGATGG - Intronic
1003504488 6:6728451-6728473 ATGTTGAAGCAGAGAATAGAAGG + Intergenic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1005039126 6:21586128-21586150 ATCCAGAATCAGAGAGAAAAAGG + Intergenic
1005117952 6:22358760-22358782 ATTGAGAAGCATAGAGAAAAAGG + Intergenic
1006064367 6:31453174-31453196 AAATAGAAGCAGAGAGAACTTGG - Intergenic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006975221 6:38094168-38094190 AAGTAGCAGCAGAGAGCTGAGGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008043659 6:46829660-46829682 AAGGAGGAGGAGAGAGAAGAAGG - Intronic
1008471771 6:51892437-51892459 AGGATGAAGAAGAGAGAAGAGGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1009678358 6:66857297-66857319 AGCTAGAAGCAGAGAGACAATGG - Intergenic
1009801810 6:68547093-68547115 ATGTAGAAACAGAGAAAATCAGG + Intergenic
1009881320 6:69569922-69569944 AGGAAGAGGAAGAGAGAAGAAGG - Intergenic
1009960777 6:70517881-70517903 AAGTAGAGGAAGAGAGATGAAGG - Intronic
1010143245 6:72635695-72635717 AGGTAGAAGCACAGAGAGAAAGG - Intronic
1010425479 6:75724558-75724580 AACTGGAAGAAGAGAGAAGATGG + Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1010824222 6:80453240-80453262 CTGAAGCAGCAAAGAGAAGATGG + Intergenic
1011179049 6:84598651-84598673 ATTTGGAAGGGGAGAGAAGATGG + Intergenic
1011253174 6:85394328-85394350 CAGTAGAAGCAGAGAGGAAATGG + Intergenic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1011608701 6:89129568-89129590 AATTAGAAACAGAGAGAAGAGGG - Intergenic
1011764674 6:90607406-90607428 AAGTATAATGAGAGAGAAGACGG + Intergenic
1012981969 6:105840660-105840682 CTGTAGAAGGAGGGAGATGAGGG - Intergenic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013788285 6:113807421-113807443 ATATGGAAGCAGAGATTAGAGGG + Intergenic
1013990620 6:116251045-116251067 ATGCAGAAGCTGAGAAATGAGGG + Exonic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014816664 6:125943234-125943256 ATCTAGAAGCAGGTAGATGAAGG + Intergenic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1015638297 6:135302761-135302783 AGGCAGAAGCAGGGGGAAGAAGG + Intronic
1015738998 6:136433386-136433408 GTGTAGATGCTGACAGAAGAAGG - Intronic
1015955103 6:138590467-138590489 AGGAAGAACCAGAGGGAAGAGGG - Intronic
1016503544 6:144750178-144750200 ATATAGAAGCACAGGGAAGGAGG - Intronic
1016799221 6:148152160-148152182 ATGTAAAAGCAGAGATAAGCAGG + Intergenic
1017030866 6:150220354-150220376 TTCTGGAAGCAGAGAGGAGAAGG + Intronic
1017294616 6:152779207-152779229 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1017791760 6:157805817-157805839 ATGTAAAAGAATACAGAAGAAGG - Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018444803 6:163845901-163845923 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1018842255 6:167525795-167525817 ACACAGAAGCAGAGAGAAGGTGG + Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019555923 7:1631284-1631306 ATGTGGAAGAAGATAGAAGGAGG - Intergenic
1019629129 7:2037239-2037261 ATTTAGAAGAATGGAGAAGATGG + Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020853885 7:13392706-13392728 ATTTTGAGGCAGAGAGAAAAAGG + Intergenic
1021252088 7:18342196-18342218 AGGAAGAATCAGAGAGGAGAGGG - Intronic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022574812 7:31487349-31487371 ATGGTGAAGGAGAGAGCAGAAGG - Intergenic
1022857519 7:34329946-34329968 AGGCTGAAGGAGAGAGAAGAAGG + Intergenic
1023043346 7:36191620-36191642 ACACAGAAGAAGAGAGAAGAAGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024020898 7:45367797-45367819 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1024130705 7:46350130-46350152 AGGAAGGAGCAGAGAGAAAAAGG - Intergenic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1026213410 7:68326989-68327011 ATCTACAAGAAGAGAGAGGAAGG + Intergenic
1026235844 7:68526717-68526739 ATGTAGAAGGAAATAGAACAAGG - Intergenic
1026400755 7:70010474-70010496 ATGTAGAGGAAAAGAGAATATGG - Intronic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1026467495 7:70667003-70667025 GTGGAAAGGCAGAGAGAAGAGGG - Intronic
1027244187 7:76355107-76355129 ATGTTGAAGAAGAGAGAAAGTGG - Intronic
1027299651 7:76817952-76817974 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
1027481985 7:78709394-78709416 ATGTAGAAGCTTAGAAAAGAAGG - Intronic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027746661 7:82083064-82083086 ATATAGAGGAAGAGAGAAAAGGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028280642 7:88923103-88923125 ATCTGGAAGCAAAGATAAGATGG + Intronic
1028663361 7:93310619-93310641 ATGTAGAAGAAGTGAACAGAGGG - Intronic
1028678292 7:93494036-93494058 ATGTAGCCTCTGAGAGAAGAAGG + Intronic
1028746830 7:94336908-94336930 TTGTGGGAGCAGAGAGAACAAGG - Intergenic
1028935548 7:96459798-96459820 ATGTAGCAGCTAAGAGTAGAGGG + Intergenic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1030180032 7:106697209-106697231 ATGCAGAGGCAGAGAGTATATGG - Intergenic
1030643397 7:112031443-112031465 ATGAGGAAGGACAGAGAAGAGGG - Intronic
1031105244 7:117533270-117533292 ATAGACAAGCAGAGAAAAGAAGG - Intronic
1031121651 7:117729037-117729059 ATGTAGAGGAAGGGAGAAGGAGG + Intronic
1031372169 7:120981705-120981727 GTGAAGATGCAGAGAGAACAGGG - Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032830311 7:135618149-135618171 AGGTACAAGGAGAAAGAAGATGG + Intronic
1032961588 7:137041622-137041644 ATGAAGAAGCAGCAAGAAAATGG - Intergenic
1032986176 7:137339827-137339849 ATGTAAAAGCAGGAAGAAAAGGG + Intronic
1033528951 7:142244232-142244254 AGAGAGAAACAGAGAGAAGAGGG - Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1033946322 7:146723190-146723212 ATGGAGATACAGTGAGAAGATGG + Intronic
1034010427 7:147523617-147523639 CTGCAGAAGCAGAGAGGAGGAGG - Intronic
1034433661 7:151053081-151053103 AAGAAGAGGCAGGGAGAAGACGG + Intergenic
1034554878 7:151844030-151844052 ATGTAGAAGGAGGTAGAAGGAGG + Intronic
1034675838 7:152891912-152891934 ATGAAGACACAGGGAGAAGACGG + Intergenic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1035119379 7:156553016-156553038 ATGTCCAAGCAGGTAGAAGAAGG - Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035766260 8:2108132-2108154 AATTAGAATCAGAAAGAAGATGG - Intronic
1035818388 8:2564865-2564887 ATTGAGAAACAGAGAGAAGGTGG + Intergenic
1035850635 8:2915819-2915841 GGGTAGGAGGAGAGAGAAGAAGG + Intergenic
1035915636 8:3618875-3618897 ATGAAGAAGCAGAGAGAAAGTGG + Intronic
1036271574 8:7309189-7309211 ATTTAGAAGTAGAGTAAAGAGGG - Intergenic
1036349774 8:8001161-8001183 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1036845048 8:12161682-12161704 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1036866417 8:12404003-12404025 ATTTAGAAGTAGAGTAAAGAGGG + Intergenic
1037061027 8:14509821-14509843 AAGTGGCAGGAGAGAGAAGAGGG + Intronic
1037067857 8:14604982-14605004 ATGTAAAAGCAGACAGTAAATGG - Intronic
1037808193 8:22069922-22069944 ATCTATAAGCAGAGAGGTGAGGG + Exonic
1037829369 8:22178877-22178899 GGGTAGAAGCACTGAGAAGAGGG - Intronic
1037866688 8:22449705-22449727 ACTAAGAAGTAGAGAGAAGATGG + Intronic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038271807 8:26081595-26081617 GTGTAGATGCACAGAGAAGCAGG - Intergenic
1038330012 8:26600888-26600910 ATCAGGAAGCAGAAAGAAGAAGG - Intronic
1038416845 8:27403068-27403090 GTCAGGAAGCAGAGAGAAGAAGG - Intronic
1038426767 8:27468972-27468994 ATCACGAAGCAGAGAGAAGCTGG - Intronic
1038680157 8:29659367-29659389 ATGTAGAAACAGAGATACAAAGG + Intergenic
1038947819 8:32380591-32380613 ATGTAGAAGCACAGGGGAGGTGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039460909 8:37743434-37743456 ATGTGCAAGAAGAGAGAAAAAGG + Intronic
1039490766 8:37945840-37945862 ATGCAGATGCAGAGAGAAGTTGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040420886 8:47239527-47239549 ATGTTGAAACACAGAGAAGGAGG - Intergenic
1040719301 8:50297793-50297815 AAGCAAAACCAGAGAGAAGAGGG + Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1041094973 8:54341227-54341249 ATGTAAAACAAGAGAGAAGATGG + Intergenic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1042182753 8:66108339-66108361 AGGAAGACGCAGGGAGAAGACGG - Intergenic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042473167 8:69214177-69214199 ATGAAGACACAGGGAGAAGATGG + Intergenic
1043242362 8:77951405-77951427 AAGTAGAGTCAGAGAGGAGATGG + Intergenic
1043374068 8:79627807-79627829 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1043392769 8:79807628-79807650 GTGAAGACGCAGGGAGAAGACGG + Intergenic
1044636610 8:94331607-94331629 ATGGACAAGCAGAGAGCAGCAGG - Intergenic
1044704670 8:94996847-94996869 ATGAAGACGCAGGGAGAAGATGG + Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045113857 8:98960800-98960822 ATGTAGAAAGACAGAGAGGAAGG - Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046158678 8:110330445-110330467 ATGTAGAAGTGGTGAGAAGGTGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046790236 8:118313907-118313929 GTGTAGAGGGAGAGAGGAGATGG + Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047263302 8:123281532-123281554 GTGGAGACGCAGGGAGAAGATGG - Intergenic
1047724494 8:127672139-127672161 AGGTAGAGGCAGAGAGCTGATGG - Intergenic
1047788333 8:128176437-128176459 AAGTAGAAGCCCAGAGAAGGAGG + Intergenic
1047888996 8:129286487-129286509 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1047923096 8:129655422-129655444 ATGTAGACCCAGAGAAAAAACGG + Intergenic
1048236339 8:132694400-132694422 GTGAAGATGCAGGGAGAAGATGG + Intronic
1048334737 8:133493924-133493946 GGGGAGAAGGAGAGAGAAGAAGG - Intronic
1048374630 8:133812500-133812522 ATAGACAAGCAGAGAGAAGTGGG - Intergenic
1049241677 8:141540520-141540542 ATGAGGAAGCAGGGAGAAGGTGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1050930682 9:11320869-11320891 TTGAAGAAGGAAAGAGAAGAGGG - Intergenic
1050951762 9:11605358-11605380 AAGCAGAAGCAGAGATAAGATGG - Intergenic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051692417 9:19729641-19729663 ATGTAGAAGCTAAGAAAAAAAGG + Intronic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1052295761 9:26894753-26894775 ATACAGAACCAGAGGGAAGAGGG - Intergenic
1052376960 9:27728492-27728514 ATGTAGAAGAGCAGAGAAGGTGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053196963 9:36127005-36127027 TTGTAGAGGCAGGGAGAGGAAGG - Intergenic
1053423235 9:37994245-37994267 AGCTGGAAGCAGAGAGAAGTTGG - Intronic
1053475916 9:38382017-38382039 AGGTAGAAGCAGACAGATCAGGG - Intergenic
1055176759 9:73327899-73327921 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1055262138 9:74449476-74449498 ATGAAGACACAGGGAGAAGATGG - Intergenic
1055728014 9:79252290-79252312 ATTTAGGAACAGAGATAAGAAGG + Intergenic
1055790085 9:79914347-79914369 ATCTAGAAGCATACAGAAAAGGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1056678529 9:88697097-88697119 AAGTAGAAGCAAGGAGACGATGG - Intergenic
1056819613 9:89829476-89829498 ATTAAGAAGCAGAGAGAACAGGG + Intergenic
1057116605 9:92528970-92528992 ATGTTCAAGAAGTGAGAAGAAGG + Intronic
1057270456 9:93647387-93647409 CTGCAGAAGCAGGGAGGAGATGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057886662 9:98834805-98834827 ATTTAGAAGCATAGAGAGCAAGG - Intronic
1057931361 9:99196291-99196313 GTGGAGAAGAAGAGAGCAGAAGG - Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058022699 9:100106203-100106225 AGGAAGATGAAGAGAGAAGATGG - Intronic
1058111229 9:101032466-101032488 ATATAGGAGCACACAGAAGAAGG - Intronic
1058462578 9:105196812-105196834 TTATAGAAGCTGAGAGAAGATGG + Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059003682 9:110377900-110377922 TCATAGAAGCAGAGAGTAGATGG - Intronic
1059424865 9:114214700-114214722 AGATGGGAGCAGAGAGAAGAGGG - Intronic
1059696755 9:116737046-116737068 ATGCAGAAAGACAGAGAAGATGG + Intronic
1059743039 9:117171681-117171703 AGGCAGTAGGAGAGAGAAGAAGG - Intronic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1061281937 9:129602583-129602605 AGGGAAAAACAGAGAGAAGAAGG + Intergenic
1061629639 9:131863972-131863994 ATGGAGACGCAGAGAGGATAAGG - Intronic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185773885 X:2786827-2786849 ATGAAGACACAGGGAGAAGACGG + Intronic
1186129250 X:6448581-6448603 ATGAAGACACAGGGAGAAGATGG - Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186327867 X:8499118-8499140 ATGAAGAAAGAGAGAAAAGAAGG + Intergenic
1186373206 X:8967833-8967855 AGGTGGCAGGAGAGAGAAGAGGG + Intergenic
1186619535 X:11224304-11224326 AAGATGAAGAAGAGAGAAGAAGG + Intronic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187068958 X:15868946-15868968 ATGAAGACACAGTGAGAAGATGG - Intergenic
1187283074 X:17876793-17876815 AGGTAGGAGCAGAGAGAAACAGG + Intergenic
1187354093 X:18550365-18550387 TGGTAGAAGCAGGGAGAAAATGG + Intronic
1187359011 X:18607035-18607057 ATGTCGAAGCTCAGAGAAGTTGG + Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187840528 X:23482407-23482429 ATGTTGAATCATAGAGACGATGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188267012 X:28089398-28089420 AAGATGATGCAGAGAGAAGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189131491 X:38502687-38502709 GTGCAGAAGCACAGAGAAAAGGG - Intronic
1189289757 X:39876822-39876844 CTGTTGATGCAGAGAGAAGCAGG + Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189731889 X:44029551-44029573 AAGTCGAAGCAGAGAGGCGACGG + Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1190438531 X:50452422-50452444 AGGTAGAAGCCTAGTGAAGAAGG - Intronic
1190817655 X:53942681-53942703 TTGTAGAAGCATATAGAAAAAGG + Intronic
1191792556 X:64986403-64986425 ATGTAGTAGCAGAGAGATGGGGG - Intronic
1191823504 X:65339117-65339139 ATTAAGAAGCAGGGAAAAGATGG + Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192369098 X:70498709-70498731 AGGAAGAAGCATAGAGAAGAAGG - Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193542289 X:82787344-82787366 ATCTAGAAGAAGAGAGATGGTGG - Intergenic
1193988161 X:88272876-88272898 ATGAAGACACAGGGAGAAGATGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1195152410 X:102085394-102085416 ATGTAGCATCAGAAAGTAGAAGG - Intergenic
1195683736 X:107567532-107567554 ATGAATTAGCAGAGAGAAGTGGG + Intronic
1195791229 X:108589143-108589165 GTGTAGATGCAGAGAGAATAAGG + Intronic
1196698103 X:118635524-118635546 ATGCAAAGGCAGAGAGAAAAAGG + Intronic
1197302944 X:124803260-124803282 ATTTAGAAGCAGTAAGAAGGGGG - Intronic
1197824677 X:130576071-130576093 GTGTAGATGCAGCGGGAAGAAGG - Intergenic
1198194931 X:134350695-134350717 AGGGAGAAAGAGAGAGAAGATGG - Intergenic
1198247126 X:134840896-134840918 ATGAACAAGCAGTGAGTAGAGGG - Intronic
1198471414 X:136950427-136950449 ATGCAGAAGCACAGAGGAAAGGG - Intergenic
1198520801 X:137450453-137450475 ATGGAGAAAAAAAGAGAAGAGGG - Intergenic
1198634591 X:138681796-138681818 AAGTAGAAACAGAGAGATGGGGG + Intronic
1198885951 X:141337423-141337445 ATATAGAAACAGAGAGTAGAAGG - Intergenic
1199101082 X:143801317-143801339 ATGCAGAAGAAAAGAGAAGAAGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199222371 X:145332355-145332377 TTATAGAAGTAGAGAGTAGAAGG - Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199495793 X:148451020-148451042 GTGAAGATGCAGAGAGAAGGTGG - Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1201146283 Y:11067085-11067107 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146385 Y:11067399-11067421 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201295812 Y:12462325-12462347 ATGAAGACACAGGGAGAAGACGG - Intergenic
1201540079 Y:15096555-15096577 ATGGAGAGGGAGGGAGAAGAAGG - Intergenic
1201693371 Y:16794449-16794471 ATGTAGAATCAGTGGGAACATGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic