ID: 1122686478

View in Genome Browser
Species Human (GRCh38)
Location 14:103510383-103510405
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122686478_1122686483 8 Left 1122686478 14:103510383-103510405 CCCAAGGATGAGATAGGTGGCTG No data
Right 1122686483 14:103510414-103510436 TCATGTCTTGCTTTATAGCCTGG No data
1122686478_1122686486 25 Left 1122686478 14:103510383-103510405 CCCAAGGATGAGATAGGTGGCTG No data
Right 1122686486 14:103510431-103510453 GCCTGGCCTGTTGGGTCTCCAGG No data
1122686478_1122686484 16 Left 1122686478 14:103510383-103510405 CCCAAGGATGAGATAGGTGGCTG No data
Right 1122686484 14:103510422-103510444 TGCTTTATAGCCTGGCCTGTTGG No data
1122686478_1122686485 17 Left 1122686478 14:103510383-103510405 CCCAAGGATGAGATAGGTGGCTG No data
Right 1122686485 14:103510423-103510445 GCTTTATAGCCTGGCCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122686478 Original CRISPR CAGCCACCTATCTCATCCTT GGG (reversed) Intergenic
No off target data available for this crispr