ID: 1122687719

View in Genome Browser
Species Human (GRCh38)
Location 14:103518013-103518035
Sequence CGAGGTGAACACAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122687719_1122687730 11 Left 1122687719 14:103518013-103518035 CCCTCAGCCCTGTGTTCACCTCG No data
Right 1122687730 14:103518047-103518069 ACACCACCCCAGCGATTGTCAGG No data
1122687719_1122687732 15 Left 1122687719 14:103518013-103518035 CCCTCAGCCCTGTGTTCACCTCG No data
Right 1122687732 14:103518051-103518073 CACCCCAGCGATTGTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122687719 Original CRISPR CGAGGTGAACACAGGGCTGA GGG (reversed) Intergenic
No off target data available for this crispr