ID: 1122688180

View in Genome Browser
Species Human (GRCh38)
Location 14:103519779-103519801
Sequence CGGCGAACATCAGGGGTGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122688171_1122688180 23 Left 1122688171 14:103519733-103519755 CCAAGGGTGACGGAAGTCTCTAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1122688180 14:103519779-103519801 CGGCGAACATCAGGGGTGCATGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122688180 Original CRISPR CGGCGAACATCAGGGGTGCA TGG Exonic
900898525 1:5501372-5501394 CGCTGGACATCAGGGGTGCTGGG - Intergenic
907410828 1:54282151-54282173 CGGTGCAGAGCAGGGGTGCATGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
914676950 1:149913100-149913122 CTGGGAACATCTTGGGTGCAGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071559283 10:86632563-86632585 GGGCCAGCCTCAGGGGTGCATGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076997974 11:308300-308322 CGGTGGACATCGGGGGAGCAGGG - Exonic
1081867552 11:46367832-46367854 CGGCCCACAGCAGGGGTGCCAGG - Intronic
1081957859 11:47109172-47109194 CAGGGAACATCAGAAGTGCAGGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1089872203 11:121685601-121685623 CAGAGAACATCAGAGGTGGAAGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1103500901 12:121400636-121400658 AGGAGAACAGGAGGGGTGCAGGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1108815023 13:54280022-54280044 AGGTGAATACCAGGGGTGCAAGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113390506 13:109892157-109892179 CATCTAACATCAGGGGTGCATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115359441 14:32484791-32484813 CGGCGAACATCAGTGGGATAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1121521593 14:94589761-94589783 CAGAGAACATCAGGGGTCCAGGG + Intronic
1122688180 14:103519779-103519801 CGGCGAACATCAGGGGTGCATGG + Exonic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132677563 16:1126953-1126975 AGGCGGACATGAAGGGTGCAGGG + Intergenic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1136109653 16:28056858-28056880 GTGGGGACATCAGGGGTGCAGGG + Intronic
1137262397 16:46842552-46842574 TGGCCGACATCAGGGGTGCATGG + Intergenic
1147323316 17:39658750-39658772 CGGAGAACAGCAGGGGTCCACGG - Exonic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929950679 2:46407419-46407441 CGGCGAACCTCTGGAGGGCAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934491031 2:94762164-94762186 GGGTGGACATCTGGGGTGCAGGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
947743356 2:232495103-232495125 CGGCGCTCATCTGGGGTTCAGGG + Intergenic
1171398954 20:24859292-24859314 CGGCTTCCCTCAGGGGTGCAGGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1175080594 20:56417348-56417370 CGGGGAACAGCAGGGGAGAAGGG - Intronic
1176545772 21:8197473-8197495 CCGCGGACATCAGGTGGGCACGG - Intergenic
1176564723 21:8380518-8380540 CCGCGGACATCAGGTGGGCACGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1203250643 22_KI270733v1_random:113710-113732 CCGCGGACATCAGGTGGGCACGG - Intergenic
950463688 3:13140728-13140750 GGGCTGACCTCAGGGGTGCAGGG + Intergenic
950638607 3:14333434-14333456 TGGGGAACATCAGGGCTGAAAGG + Intergenic
952736151 3:36693441-36693463 CTGCTACCAGCAGGGGTGCATGG + Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
963012656 3:140787511-140787533 GGGAGACCATCAGGTGTGCAGGG + Intergenic
968350001 3:198046116-198046138 CGGTGGACAGCTGGGGTGCAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981861793 4:149364244-149364266 TGGGGAAAATCAGGAGTGCAGGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989614997 5:43330381-43330403 AGGCTGAGATCAGGGGTGCAGGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
997358327 5:133278637-133278659 TGGCGGACATGAGAGGTGCAAGG + Intronic
999387065 5:151161480-151161502 CTGATAACATCAAGGGTGCAGGG - Intergenic
1001703053 5:173721300-173721322 CGGGAAACATTAGGGGTGCATGG - Intergenic
1004066058 6:12245651-12245673 CCCAGAACATCAGGGGTGGAGGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1016649266 6:146445403-146445425 CGGAGAGCCTCAGAGGTGCAGGG + Intergenic
1018696968 6:166397877-166397899 CTGGGAACATCACGGGTACAGGG + Intergenic
1019649612 7:2149710-2149732 CGGTGAACAACAGGGTTGCTGGG - Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023110807 7:36808769-36808791 CGGCTAAGATAATGGGTGCAGGG + Intergenic
1023835953 7:44067238-44067260 CAGCGACCATCAGGGGCACATGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028285928 7:88998789-88998811 GGGCCAAAAGCAGGGGTGCAGGG + Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035725943 8:1824677-1824699 CGGGGGACAGCTGGGGTGCAGGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1052880733 9:33599705-33599727 GGGTGGACATCTGGGGTGCAGGG - Intergenic
1053495235 9:38544505-38544527 GGGTGGACATCTGGGGTGCAGGG + Intronic
1053666956 9:40323517-40323539 GGGTGGACATCTGGGGTGCAGGG - Intronic
1053916547 9:42948626-42948648 GGGTGGACATCTGGGGTGCAGGG - Intergenic
1054378106 9:64463545-64463567 GGGTGGACATCTGGGGTGCAGGG - Intergenic
1054517654 9:66052766-66052788 GGGTGGACATCTGGGGTGCAGGG + Intergenic
1203467044 Un_GL000220v1:96982-97004 CCGCGGACATCAGGTGGGCACGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic