ID: 1122688441

View in Genome Browser
Species Human (GRCh38)
Location 14:103520846-103520868
Sequence GCTCCTACCCCCACTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122688441_1122688448 -1 Left 1122688441 14:103520846-103520868 CCCCCCACAGTGGGGGTAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1122688448 14:103520868-103520890 CCCTGCCCCTGGAGAAGCTTTGG 0: 1
1: 0
2: 3
3: 32
4: 458
1122688441_1122688455 29 Left 1122688441 14:103520846-103520868 CCCCCCACAGTGGGGGTAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1122688455 14:103520898-103520920 AGCCCCTGGTAGAATCCCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 132
1122688441_1122688453 15 Left 1122688441 14:103520846-103520868 CCCCCCACAGTGGGGGTAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1122688453 14:103520884-103520906 GCTTTGGCGTCACCAGCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122688441 Original CRISPR GCTCCTACCCCCACTGTGGG GGG (reversed) Intronic
900600391 1:3500282-3500304 GGTCTGTCCCCCACTGTGGGAGG - Intronic
902005146 1:13225983-13226005 GCTCTTCCCCCCACTGTTCGTGG - Intergenic
902890602 1:19440592-19440614 GCTCCTATGACCAGTGTGGGGGG + Intronic
903892801 1:26581201-26581223 GCAACTACCTCCACTGGGGGTGG - Intergenic
905931091 1:41788171-41788193 GCTCCTGTCCTCACTGTCGGGGG - Intronic
906908570 1:49921846-49921868 GGACCCACCCTCACTGTGGGTGG - Intronic
907485535 1:54775361-54775383 GCTCCTCCCCTCACTATGAGTGG - Intergenic
907713785 1:56908951-56908973 CCTCCTTGCCCCACTGTGGGTGG - Intronic
908781654 1:67696283-67696305 GCTCCTACTAGCACTGTGGTAGG - Intergenic
911155363 1:94630962-94630984 GCTCCCACCTCCACTGTAGCAGG - Intergenic
915997324 1:160576478-160576500 GCTCCTTCCTCCTCTGTGGGTGG + Intronic
920342597 1:205284822-205284844 GCTCCTGCTCCCTCTGGGGGAGG - Intergenic
922422851 1:225471216-225471238 GCTCAGAGCCCCACTGTGGGAGG + Intergenic
924813913 1:247426426-247426448 CTTCCTACAACCACTGTGGGTGG - Intronic
1063348593 10:5334715-5334737 ACTCCTTCACCCACTGTGGAAGG - Intergenic
1067836770 10:49646344-49646366 CCACCTTGCCCCACTGTGGGTGG - Intronic
1067850093 10:49749265-49749287 GCTCCCACCCCCTCCCTGGGAGG - Intronic
1069859094 10:71459348-71459370 GCTCATGCCCCCACTTTGGGAGG - Intronic
1073440321 10:103548893-103548915 GCTCCCACCCTCCATGTGGGTGG + Intronic
1073509447 10:104034222-104034244 GCTGCTACCCCGACTGTGGGAGG + Exonic
1074163555 10:110855134-110855156 GATGCCACACCCACTGTGGGAGG - Intergenic
1074192003 10:111146235-111146257 GCTGCTTCCCCTACTGAGGGAGG + Intergenic
1075069976 10:119314163-119314185 GCTTTTGCCCCCACTTTGGGTGG + Intronic
1075722278 10:124594069-124594091 GCTCCCACCAGCACTTTGGGAGG + Intronic
1075783723 10:125033827-125033849 GCTCCGGGCCACACTGTGGGAGG + Intronic
1075855118 10:125623300-125623322 GGACCTACCCTCAATGTGGGTGG - Intronic
1076237861 10:128879715-128879737 TCTGCCAGCCCCACTGTGGGTGG + Intergenic
1076862251 10:133143735-133143757 TCTCTCTCCCCCACTGTGGGCGG + Intergenic
1077007489 11:365154-365176 GCTCCCACCCCAGCTGTGGATGG + Intergenic
1078486759 11:11730437-11730459 GGTTCTAGCCCCACTGTGGTGGG - Intergenic
1078878037 11:15417875-15417897 GGGCCTACCCACATTGTGGGGGG - Intergenic
1081539255 11:44018135-44018157 GTTCCTTCCCCCACTGGGGCTGG - Intergenic
1083791804 11:64990460-64990482 GCCCCTACGAGCACTGTGGGAGG + Intronic
1084182257 11:67452632-67452654 ACTCCTACCCCCAAGGTGGCTGG - Exonic
1084477004 11:69394764-69394786 GCTCCTGTCCCCACGGCGGGGGG - Intergenic
1084949276 11:72655884-72655906 GCTGCAGCCCCCACTCTGGGGGG - Intronic
1085692388 11:78674316-78674338 CCACCTGCCACCACTGTGGGTGG + Intronic
1087159684 11:94936511-94936533 GCTCCTGCTCCCACTGGGCGTGG + Intergenic
1088194994 11:107264413-107264435 TCTCCTTCCCCAACTGAGGGAGG + Intergenic
1088205791 11:107390878-107390900 GTTCCCACCCACACTGAGGGTGG - Intronic
1088441656 11:109877692-109877714 CCTCCCACTCCCACTGTGGGTGG + Intergenic
1088808645 11:113374270-113374292 GCTCCTAGCCCATCTGGGGGAGG - Intronic
1090187988 11:124750827-124750849 GTGGCCACCCCCACTGTGGGGGG + Exonic
1091934383 12:4423615-4423637 GCTCTGACCCCTACTGTGGCTGG + Intergenic
1093941344 12:25058204-25058226 GCTCCCACCAGCAGTGTGGGTGG + Intronic
1097187293 12:57202635-57202657 GCTCCTGCCCCCACCCTGGGAGG - Intronic
1101439928 12:104695961-104695983 CCTCCCACCCCCACTTTGGCAGG + Intronic
1103560366 12:121790294-121790316 GCCCCTTCCGCCACTGTGTGTGG + Intronic
1103833337 12:123798367-123798389 GCTCCTGCTCCCACTGTGTGAGG - Intronic
1107711725 13:43157138-43157160 TCTCCCACAGCCACTGTGGGTGG + Intergenic
1110262576 13:73502029-73502051 GCTCCTAGCTCTGCTGTGGGAGG - Intergenic
1110666527 13:78123898-78123920 GTTGCCACCCCCAATGTGGGTGG + Intergenic
1115895437 14:38081340-38081362 GTTCCTATCTCCACTGTGAGAGG - Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119522965 14:75299517-75299539 GCTCATCCCAGCACTGTGGGAGG + Intergenic
1119739980 14:77008033-77008055 GCTCCCTCCCCCACAGTGGGAGG + Intergenic
1121118642 14:91361511-91361533 GCTCCTATCCACACTGCAGGAGG + Intronic
1122481224 14:102048799-102048821 GCTCTTACCCTCAAGGTGGGCGG + Intronic
1122613533 14:103001543-103001565 GCTGCAGCCCCCACTGTGGCCGG - Intronic
1122688441 14:103520846-103520868 GCTCCTACCCCCACTGTGGGGGG - Intronic
1122899610 14:104776925-104776947 GGTCCTAGCCCCACTCTGTGAGG - Intronic
1123058551 14:105584039-105584061 CCACCTGCTCCCACTGTGGGGGG - Intergenic
1123082885 14:105704273-105704295 CCACCTGCTCCCACTGTGGGGGG - Intergenic
1124212332 15:27774205-27774227 TCACCTCACCCCACTGTGGGGGG + Intronic
1125578583 15:40770684-40770706 GCTCGTCCCCCCACAGTGGCAGG - Exonic
1127775651 15:62262328-62262350 CATCCAACCCCCACTGTGGGAGG + Intergenic
1127958996 15:63877063-63877085 CCTCCCACTCCCACTGTGGGTGG + Intergenic
1128241333 15:66103151-66103173 GGTCTGACCCCCACTGTGTGCGG - Intronic
1128256874 15:66203193-66203215 GCTCCTACCCCACTTGGGGGTGG - Intronic
1129921838 15:79325927-79325949 CCACCTACCCTCAATGTGGGTGG - Intronic
1132657357 16:1046851-1046873 GCTCAGAGCCCCACTGTGTGAGG + Intergenic
1132939974 16:2501651-2501673 GCTCCCACCCTCCCTGGGGGTGG - Exonic
1135864875 16:26092063-26092085 TCTCCTGGCCCCACGGTGGGAGG + Intronic
1136290248 16:29267369-29267391 TCTCTTACCCCCACTGAGAGAGG - Intergenic
1137997068 16:53228982-53229004 GCTCCTATCTTCACTGTGAGTGG + Exonic
1139078937 16:63490590-63490612 GATCCTACCCCCTAAGTGGGTGG + Intergenic
1140316396 16:73902022-73902044 GTGCCCACCCACACTGTGGGTGG - Intergenic
1140896623 16:79330559-79330581 GTTCCTCCCCACCCTGTGGGTGG - Intergenic
1141788297 16:86216331-86216353 CCTCCTTCCCTCTCTGTGGGAGG - Intergenic
1142096132 16:88240890-88240912 TCTCTTACCCCCACTGAGAGAGG - Intergenic
1142540330 17:653937-653959 TGTCATACCCACACTGTGGGAGG + Intronic
1142859380 17:2751634-2751656 GCTACTAGCTGCACTGTGGGTGG + Intergenic
1143316470 17:6036941-6036963 GCTCTGAGCCCCACTGTGGTGGG + Intronic
1145891084 17:28416235-28416257 GCTCCTAAGCCCCCTGTGGTAGG + Intergenic
1146001366 17:29132496-29132518 GCTCCTACCCACATTGTGCTGGG - Intronic
1147556212 17:41480840-41480862 GCCCCCACCCCCACTGTAGCTGG + Exonic
1150250386 17:63701213-63701235 GCGCCTTCCCACACTGTGGCAGG + Intergenic
1150961740 17:69921082-69921104 GCTCCCAGCCCCACTTTAGGAGG - Intergenic
1151615559 17:75208014-75208036 GCTCCTGCCAGCACTTTGGGAGG - Intronic
1151934880 17:77255481-77255503 GCTTAAACCCCCACTGGGGGAGG - Intergenic
1152612873 17:81324140-81324162 GGTCTTACCGTCACTGTGGGTGG - Intronic
1152647849 17:81477973-81477995 GCTCCCACCCGCAGTGTGGGTGG - Intergenic
1153503022 18:5768181-5768203 GCTGCTACCTCCCCTGTGGCTGG + Intergenic
1160857701 19:1224737-1224759 CCTGCTAAGCCCACTGTGGGTGG + Intronic
1161314227 19:3610418-3610440 ACTGTCACCCCCACTGTGGGAGG + Intergenic
1161937485 19:7381072-7381094 GCTCCTGCCCCCAGCATGGGGGG - Intronic
1163527430 19:17830280-17830302 GCCCCTACCCCCACCACGGGTGG - Intronic
1163548291 19:17951857-17951879 GCTGCTCCCCTCACTCTGGGGGG - Intronic
1163604349 19:18265927-18265949 GCTGCTACCGCCACTTGGGGTGG + Exonic
1165745851 19:38229267-38229289 ACCCCTACCCCCACTCTGGGTGG + Intronic
1165791549 19:38495746-38495768 ATTCCTACAGCCACTGTGGGAGG - Intronic
1165887095 19:39085827-39085849 GCTCTTACTCCCACAGTGGAAGG - Intronic
1167575263 19:50314830-50314852 GCTCCCCTCCCCCCTGTGGGGGG - Intronic
1167785210 19:51630299-51630321 GCTGCTGCCCCTGCTGTGGGGGG - Intronic
1167787309 19:51646723-51646745 GCTGCTGCCCCTGCTGTGGGGGG - Exonic
1168358728 19:55719845-55719867 CCTCCCACCCCCATTGTGTGTGG - Intronic
927009188 2:18884301-18884323 ATTCCTACCCACACTGTAGGAGG - Intergenic
927798967 2:26079275-26079297 GCTCCTACCCCCACTCCGTGAGG - Intronic
931776906 2:65548774-65548796 GCTCATCTCCCCACTCTGGGTGG - Intergenic
932214459 2:69958003-69958025 GTTCAAACGCCCACTGTGGGAGG + Intergenic
932920263 2:75905850-75905872 GTGCCTACCCACATTGTGGGTGG - Intergenic
934927564 2:98392092-98392114 CCACCTACCCTCACTGTCGGAGG - Intronic
935086996 2:99857946-99857968 CCTCCTCCTCCCACTGTGGATGG + Intronic
937664417 2:124468515-124468537 GGGCCCACCCACACTGTGGGTGG + Intronic
937786589 2:125906371-125906393 AGTCCTACCCTCAGTGTGGGTGG + Intergenic
938012391 2:127839346-127839368 GCTCATACCAGCACTTTGGGAGG + Intergenic
941625024 2:167822023-167822045 GCTGCTTCCTCCACTGTGTGGGG - Intergenic
944991152 2:205237356-205237378 GCTCCCACCTACACTTTGGGAGG - Intronic
948437156 2:237961478-237961500 CCTCCTGCCCTCACTGTGGGTGG - Intergenic
1170177900 20:13493349-13493371 GCACCTACCCACATTGAGGGTGG - Intronic
1171104140 20:22416368-22416390 GATCCTAACACCACTCTGGGGGG + Intergenic
1172083302 20:32358894-32358916 GCCCCTCCCCCCCCAGTGGGGGG - Intronic
1172660634 20:36565969-36565991 GCTCATACCAGCACTTTGGGAGG - Intergenic
1173846673 20:46192917-46192939 CCTCCTGCTCCCACTGGGGGGGG - Intronic
1174110839 20:48196769-48196791 ACACCCACCCCCACTGTGGAGGG + Intergenic
1178732737 21:35119815-35119837 GCTCCTTCCCTCACCCTGGGTGG + Intronic
1179942809 21:44650729-44650751 GCTCCAGCCCCCAGTGAGGGTGG + Intronic
1180964024 22:19776343-19776365 CCTCCCACCCCCAGTGAGGGAGG - Intronic
1182065832 22:27431051-27431073 GCCCCCAGCCCCACTCTGGGTGG - Intergenic
1184113446 22:42408782-42408804 GCTCCTGCTCACACTGTGGGTGG - Intronic
1185322025 22:50205872-50205894 GCCCCCACACCCACAGTGGGAGG - Intronic
1185336441 22:50272699-50272721 TCTCCTCCCACCACTCTGGGAGG + Intergenic
952099338 3:29993542-29993564 ATTCCACCCCCCACTGTGGGAGG + Intronic
953407547 3:42666911-42666933 GCTCCTATCCCCAGTGGGGCAGG - Intergenic
953868922 3:46609453-46609475 GTTCCTGCCCCCACTGGGGGAGG + Intronic
954622794 3:52005416-52005438 TCTCTTATCCCCACTCTGGGCGG - Intergenic
957634103 3:82759533-82759555 GATGTTGCCCCCACTGTGGGTGG - Intergenic
967812854 3:193775060-193775082 TCTCCTGGCCCGACTGTGGGAGG + Intergenic
968385891 4:137099-137121 GCTCCTGCTCCCACTATGTGAGG + Intronic
969374640 4:6755246-6755268 GCTGCTGCCCCCAGGGTGGGTGG - Intergenic
971466421 4:26967829-26967851 TCTCTAACCCCCACTGTTGGAGG - Intronic
977554075 4:98471039-98471061 GCTCCTGCCCCCACTTTAGGTGG - Exonic
980804039 4:137789173-137789195 GCTTTTACTCCCACTGTTGGTGG + Intergenic
981739137 4:147984501-147984523 GCTCCCACCTCCCTTGTGGGAGG + Intronic
982060411 4:151598969-151598991 GCCCCCAGCCCCACTGGGGGAGG + Intronic
995745345 5:115396236-115396258 TATCCTAACCTCACTGTGGGAGG + Intergenic
996544847 5:124667449-124667471 CCTCCCACCCCCACCGTGGCTGG + Intronic
997459256 5:134041322-134041344 GTACCTACACCCACTCTGGGAGG + Intergenic
997720111 5:136071263-136071285 TCTCCTCCCTCCACTGTAGGAGG - Intergenic
1005104306 6:22206763-22206785 CCTCCCACCACCACTGTGGGAGG + Intergenic
1006313877 6:33279160-33279182 GCCCCTTCCCCAACTGGGGGTGG - Exonic
1009969218 6:70608979-70609001 GCTCCTCCTCGCACTATGGGTGG + Intergenic
1010131638 6:72500862-72500884 TCCCCTGCCCCCACTGTGAGTGG - Intergenic
1012577407 6:100819755-100819777 GCACCCACCCCGACTGAGGGTGG + Intronic
1015838932 6:137455227-137455249 GCACCTACCCACACTGAGGAGGG + Intergenic
1016753035 6:147651920-147651942 ACTCCGACCCCCACTCTGTGCGG - Intronic
1017759170 6:157554968-157554990 GCTCCCACTCCCACTTCGGGTGG - Intronic
1019300796 7:302501-302523 GCTCCTAGCCCCGCTGTGCCTGG - Intergenic
1019462017 7:1164889-1164911 GTGCCCACCCCCACTGAGGGTGG + Intergenic
1019716401 7:2541381-2541403 GCCCCTGCCTCCAGTGTGGGGGG - Exonic
1019846984 7:3513198-3513220 TCTCCCAGCACCACTGTGGGTGG + Intronic
1019872126 7:3774286-3774308 GCACCTTCCCCCACTGTTGTAGG - Intronic
1021813852 7:24428607-24428629 GCTTCTATCCCCACTGGGGTGGG - Intergenic
1024270835 7:47640158-47640180 GCTGCTAACCCCTGTGTGGGAGG + Intergenic
1024627778 7:51223066-51223088 GCTCCTAGTCACACTGTGGAGGG - Intronic
1025259509 7:57408980-57409002 GCTCATACCAGCACTTTGGGAGG + Intergenic
1026586528 7:71660348-71660370 CCTCCTCCCTCCACTGTGTGAGG + Intronic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1027451122 7:78332750-78332772 GCTCTCACCCTCACTGTGAGAGG + Intronic
1029268156 7:99358794-99358816 GCTCATGCCCGCACTTTGGGAGG - Intronic
1029607712 7:101609150-101609172 GCTCCTGTTCCCTCTGTGGGAGG - Intergenic
1030646395 7:112066170-112066192 GCACCCTCACCCACTGTGGGTGG + Intronic
1034872556 7:154696833-154696855 GCTCCTAACTCCACTCTGGGTGG - Intronic
1039616137 8:38956379-38956401 GCTCCTTGCCTCACTGTGCGGGG - Intronic
1045111065 8:98940124-98940146 GCTCCTACCCCCTCGGCGTGCGG + Intronic
1050045997 9:1545728-1545750 GCACCTGACCACACTGTGGGTGG + Intergenic
1050944441 9:11499668-11499690 GCTGCTCCACCCATTGTGGGAGG - Intergenic
1051206268 9:14692952-14692974 GCTCCTCCCTCAACTGGGGGTGG - Intronic
1052997659 9:34559744-34559766 GCTCCTGCCACCGCTGGGGGTGG + Intronic
1055113971 9:72587608-72587630 GCTTCTACCACCACTATGAGAGG + Intronic
1056092510 9:83218512-83218534 GGTCCTACCCCCACGGTCTGTGG - Intergenic
1056843693 9:90019193-90019215 ACTCCTTCTCCCACTGCGGGTGG + Intergenic
1057819260 9:98318640-98318662 ATTCCTGCCACCACTGTGGGTGG + Intronic
1060968546 9:127724906-127724928 GCTCCCGCCCCCACGGTGGGCGG + Intronic
1062419009 9:136470147-136470169 GCTCCTTCCCCCGCTTTGGTTGG - Intronic
1187161729 X:16771527-16771549 GCTTGTATCCCCGCTGTGGGAGG + Intergenic
1187702547 X:21977065-21977087 GCTCCTCCTCGCACTATGGGTGG - Exonic
1189855022 X:45215063-45215085 GCTCATGCCCACACTTTGGGAGG - Intergenic
1191841024 X:65513708-65513730 GCTCCCACACCCACTGTAGTAGG - Intronic
1192118265 X:68432071-68432093 TCTCCTTCCCCCATTGTGTGTGG - Intronic
1195537182 X:106022200-106022222 GCTCCTACCTCCACAGTGAAGGG - Intergenic
1196196318 X:112841238-112841260 GCTCCCCGCCCCACTGCGGGAGG + Intergenic