ID: 1122688513

View in Genome Browser
Species Human (GRCh38)
Location 14:103521090-103521112
Sequence TGCCGCGCCTCCTCCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122688513_1122688516 0 Left 1122688513 14:103521090-103521112 CCGGCGCAGGAGGAGGCGCGGCA 0: 1
1: 0
2: 0
3: 16
4: 186
Right 1122688516 14:103521113-103521135 CGGAACCCAGACCCGGAGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 90
1122688513_1122688515 -7 Left 1122688513 14:103521090-103521112 CCGGCGCAGGAGGAGGCGCGGCA 0: 1
1: 0
2: 0
3: 16
4: 186
Right 1122688515 14:103521106-103521128 CGCGGCACGGAACCCAGACCCGG 0: 1
1: 0
2: 0
3: 9
4: 74
1122688513_1122688517 4 Left 1122688513 14:103521090-103521112 CCGGCGCAGGAGGAGGCGCGGCA 0: 1
1: 0
2: 0
3: 16
4: 186
Right 1122688517 14:103521117-103521139 ACCCAGACCCGGAGCGCGGCCGG 0: 1
1: 0
2: 2
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122688513 Original CRISPR TGCCGCGCCTCCTCCTGCGC CGG (reversed) Intronic