ID: 1122694415 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:103545828-103545850 |
| Sequence | GACTCAGCGGCTTTGTGACG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122694415_1122694420 | 1 | Left | 1122694415 | 14:103545828-103545850 | CCTCGTCACAAAGCCGCTGAGTC | No data | ||
| Right | 1122694420 | 14:103545852-103545874 | CCCCGAAGCCCTCCTGAGCGCGG | No data | ||||
| 1122694415_1122694426 | 15 | Left | 1122694415 | 14:103545828-103545850 | CCTCGTCACAAAGCCGCTGAGTC | No data | ||
| Right | 1122694426 | 14:103545866-103545888 | TGAGCGCGGCGCTGTATGAGAGG | No data | ||||
| 1122694415_1122694427 | 25 | Left | 1122694415 | 14:103545828-103545850 | CCTCGTCACAAAGCCGCTGAGTC | No data | ||
| Right | 1122694427 | 14:103545876-103545898 | GCTGTATGAGAGGTACCCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122694415 | Original CRISPR | GACTCAGCGGCTTTGTGACG AGG (reversed) | Intergenic | ||