ID: 1122694416

View in Genome Browser
Species Human (GRCh38)
Location 14:103545841-103545863
Sequence AGGGCTTCGGGGGGACTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694416_1122694426 2 Left 1122694416 14:103545841-103545863 CCGCTGAGTCCCCCCGAAGCCCT No data
Right 1122694426 14:103545866-103545888 TGAGCGCGGCGCTGTATGAGAGG No data
1122694416_1122694427 12 Left 1122694416 14:103545841-103545863 CCGCTGAGTCCCCCCGAAGCCCT No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694416_1122694432 30 Left 1122694416 14:103545841-103545863 CCGCTGAGTCCCCCCGAAGCCCT No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694416_1122694428 25 Left 1122694416 14:103545841-103545863 CCGCTGAGTCCCCCCGAAGCCCT No data
Right 1122694428 14:103545889-103545911 TACCCAGAGGTGCTCTCAGAAGG No data
1122694416_1122694431 29 Left 1122694416 14:103545841-103545863 CCGCTGAGTCCCCCCGAAGCCCT No data
Right 1122694431 14:103545893-103545915 CAGAGGTGCTCTCAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694416 Original CRISPR AGGGCTTCGGGGGGACTCAG CGG (reversed) Intergenic