ID: 1122694417

View in Genome Browser
Species Human (GRCh38)
Location 14:103545850-103545872
Sequence GCGCTCAGGAGGGCTTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694417_1122694433 25 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694433 14:103545898-103545920 GTGCTCTCAGAAGGCAGGGCTGG No data
1122694417_1122694434 26 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694434 14:103545899-103545921 TGCTCTCAGAAGGCAGGGCTGGG No data
1122694417_1122694427 3 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694417_1122694431 20 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694431 14:103545893-103545915 CAGAGGTGCTCTCAGAAGGCAGG No data
1122694417_1122694426 -7 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694426 14:103545866-103545888 TGAGCGCGGCGCTGTATGAGAGG No data
1122694417_1122694428 16 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694428 14:103545889-103545911 TACCCAGAGGTGCTCTCAGAAGG No data
1122694417_1122694432 21 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694417 Original CRISPR GCGCTCAGGAGGGCTTCGGG GGG (reversed) Intergenic