ID: 1122694419

View in Genome Browser
Species Human (GRCh38)
Location 14:103545852-103545874
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694419_1122694432 19 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694419_1122694433 23 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694433 14:103545898-103545920 GTGCTCTCAGAAGGCAGGGCTGG No data
1122694419_1122694435 29 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694435 14:103545904-103545926 TCAGAAGGCAGGGCTGGGTTTGG No data
1122694419_1122694434 24 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694434 14:103545899-103545921 TGCTCTCAGAAGGCAGGGCTGGG No data
1122694419_1122694436 30 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694419_1122694426 -9 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694426 14:103545866-103545888 TGAGCGCGGCGCTGTATGAGAGG No data
1122694419_1122694428 14 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694428 14:103545889-103545911 TACCCAGAGGTGCTCTCAGAAGG No data
1122694419_1122694431 18 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694431 14:103545893-103545915 CAGAGGTGCTCTCAGAAGGCAGG No data
1122694419_1122694427 1 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694419 Original CRISPR CCGCGCTCAGGAGGGCTTCG GGG (reversed) Intergenic