ID: 1122694421

View in Genome Browser
Species Human (GRCh38)
Location 14:103545853-103545875
Sequence GCCGCGCTCAGGAGGGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694421_1122694433 22 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694433 14:103545898-103545920 GTGCTCTCAGAAGGCAGGGCTGG No data
1122694421_1122694437 30 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694437 14:103545906-103545928 AGAAGGCAGGGCTGGGTTTGGGG No data
1122694421_1122694431 17 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694431 14:103545893-103545915 CAGAGGTGCTCTCAGAAGGCAGG No data
1122694421_1122694427 0 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694421_1122694432 18 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694421_1122694436 29 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694421_1122694434 23 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694434 14:103545899-103545921 TGCTCTCAGAAGGCAGGGCTGGG No data
1122694421_1122694426 -10 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694426 14:103545866-103545888 TGAGCGCGGCGCTGTATGAGAGG No data
1122694421_1122694435 28 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694435 14:103545904-103545926 TCAGAAGGCAGGGCTGGGTTTGG No data
1122694421_1122694428 13 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694428 14:103545889-103545911 TACCCAGAGGTGCTCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694421 Original CRISPR GCCGCGCTCAGGAGGGCTTC GGG (reversed) Intergenic