ID: 1122694424

View in Genome Browser
Species Human (GRCh38)
Location 14:103545861-103545883
Sequence CATACAGCGCCGCGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694424_1122694436 21 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694424_1122694431 9 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694431 14:103545893-103545915 CAGAGGTGCTCTCAGAAGGCAGG No data
1122694424_1122694427 -8 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694424_1122694437 22 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694437 14:103545906-103545928 AGAAGGCAGGGCTGGGTTTGGGG No data
1122694424_1122694428 5 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694428 14:103545889-103545911 TACCCAGAGGTGCTCTCAGAAGG No data
1122694424_1122694435 20 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694435 14:103545904-103545926 TCAGAAGGCAGGGCTGGGTTTGG No data
1122694424_1122694438 26 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG No data
1122694424_1122694434 15 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694434 14:103545899-103545921 TGCTCTCAGAAGGCAGGGCTGGG No data
1122694424_1122694433 14 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694433 14:103545898-103545920 GTGCTCTCAGAAGGCAGGGCTGG No data
1122694424_1122694432 10 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694424_1122694439 27 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694439 14:103545911-103545933 GCAGGGCTGGGTTTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694424 Original CRISPR CATACAGCGCCGCGCTCAGG AGG (reversed) Intergenic