ID: 1122694427

View in Genome Browser
Species Human (GRCh38)
Location 14:103545876-103545898
Sequence GCTGTATGAGAGGTACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694416_1122694427 12 Left 1122694416 14:103545841-103545863 CCGCTGAGTCCCCCCGAAGCCCT No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694418_1122694427 2 Left 1122694418 14:103545851-103545873 CCCCCGAAGCCCTCCTGAGCGCG No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694421_1122694427 0 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694422_1122694427 -1 Left 1122694422 14:103545854-103545876 CCGAAGCCCTCCTGAGCGCGGCG No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694415_1122694427 25 Left 1122694415 14:103545828-103545850 CCTCGTCACAAAGCCGCTGAGTC No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694414_1122694427 26 Left 1122694414 14:103545827-103545849 CCCTCGTCACAAAGCCGCTGAGT No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694417_1122694427 3 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694424_1122694427 -8 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694419_1122694427 1 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data
1122694423_1122694427 -7 Left 1122694423 14:103545860-103545882 CCCTCCTGAGCGCGGCGCTGTAT No data
Right 1122694427 14:103545876-103545898 GCTGTATGAGAGGTACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694427 Original CRISPR GCTGTATGAGAGGTACCCAG AGG Intergenic
No off target data available for this crispr