ID: 1122694430

View in Genome Browser
Species Human (GRCh38)
Location 14:103545892-103545914
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694430_1122694442 6 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694442 14:103545921-103545943 GTTTGGGGCAGGGCAGGAGTGGG No data
1122694430_1122694440 0 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694440 14:103545915-103545937 GGCTGGGTTTGGGGCAGGGCAGG No data
1122694430_1122694443 16 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694443 14:103545931-103545953 GGGCAGGAGTGGGTACCGAGAGG No data
1122694430_1122694436 -10 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694430_1122694439 -4 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694439 14:103545911-103545933 GCAGGGCTGGGTTTGGGGCAGGG No data
1122694430_1122694437 -9 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694437 14:103545906-103545928 AGAAGGCAGGGCTGGGTTTGGGG No data
1122694430_1122694441 5 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694441 14:103545920-103545942 GGTTTGGGGCAGGGCAGGAGTGG No data
1122694430_1122694438 -5 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694430 Original CRISPR CTGCCTTCTGAGAGCACCTC TGG (reversed) Intergenic