ID: 1122694432

View in Genome Browser
Species Human (GRCh38)
Location 14:103545894-103545916
Sequence AGAGGTGCTCTCAGAAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694424_1122694432 10 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694416_1122694432 30 Left 1122694416 14:103545841-103545863 CCGCTGAGTCCCCCCGAAGCCCT No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694418_1122694432 20 Left 1122694418 14:103545851-103545873 CCCCCGAAGCCCTCCTGAGCGCG No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694422_1122694432 17 Left 1122694422 14:103545854-103545876 CCGAAGCCCTCCTGAGCGCGGCG No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694423_1122694432 11 Left 1122694423 14:103545860-103545882 CCCTCCTGAGCGCGGCGCTGTAT No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694417_1122694432 21 Left 1122694417 14:103545850-103545872 CCCCCCGAAGCCCTCCTGAGCGC No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694425_1122694432 7 Left 1122694425 14:103545864-103545886 CCTGAGCGCGGCGCTGTATGAGA No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694421_1122694432 18 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data
1122694419_1122694432 19 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694432 14:103545894-103545916 AGAGGTGCTCTCAGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694432 Original CRISPR AGAGGTGCTCTCAGAAGGCA GGG Intergenic
No off target data available for this crispr