ID: 1122694436

View in Genome Browser
Species Human (GRCh38)
Location 14:103545905-103545927
Sequence CAGAAGGCAGGGCTGGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694424_1122694436 21 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694425_1122694436 18 Left 1122694425 14:103545864-103545886 CCTGAGCGCGGCGCTGTATGAGA No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694430_1122694436 -10 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694419_1122694436 30 Left 1122694419 14:103545852-103545874 CCCCGAAGCCCTCCTGAGCGCGG No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694421_1122694436 29 Left 1122694421 14:103545853-103545875 CCCGAAGCCCTCCTGAGCGCGGC No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694429_1122694436 -9 Left 1122694429 14:103545891-103545913 CCCAGAGGTGCTCTCAGAAGGCA No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694422_1122694436 28 Left 1122694422 14:103545854-103545876 CCGAAGCCCTCCTGAGCGCGGCG No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data
1122694423_1122694436 22 Left 1122694423 14:103545860-103545882 CCCTCCTGAGCGCGGCGCTGTAT No data
Right 1122694436 14:103545905-103545927 CAGAAGGCAGGGCTGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694436 Original CRISPR CAGAAGGCAGGGCTGGGTTT GGG Intergenic
No off target data available for this crispr