ID: 1122694438

View in Genome Browser
Species Human (GRCh38)
Location 14:103545910-103545932
Sequence GGCAGGGCTGGGTTTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694429_1122694438 -4 Left 1122694429 14:103545891-103545913 CCCAGAGGTGCTCTCAGAAGGCA No data
Right 1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG No data
1122694424_1122694438 26 Left 1122694424 14:103545861-103545883 CCTCCTGAGCGCGGCGCTGTATG No data
Right 1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG No data
1122694423_1122694438 27 Left 1122694423 14:103545860-103545882 CCCTCCTGAGCGCGGCGCTGTAT No data
Right 1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG No data
1122694430_1122694438 -5 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG No data
1122694425_1122694438 23 Left 1122694425 14:103545864-103545886 CCTGAGCGCGGCGCTGTATGAGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1122694438 14:103545910-103545932 GGCAGGGCTGGGTTTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694438 Original CRISPR GGCAGGGCTGGGTTTGGGGC AGG Intergenic