ID: 1122694441

View in Genome Browser
Species Human (GRCh38)
Location 14:103545920-103545942
Sequence GGTTTGGGGCAGGGCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694429_1122694441 6 Left 1122694429 14:103545891-103545913 CCCAGAGGTGCTCTCAGAAGGCA No data
Right 1122694441 14:103545920-103545942 GGTTTGGGGCAGGGCAGGAGTGG No data
1122694430_1122694441 5 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694441 14:103545920-103545942 GGTTTGGGGCAGGGCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694441 Original CRISPR GGTTTGGGGCAGGGCAGGAG TGG Intergenic