ID: 1122694441 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:103545920-103545942 |
Sequence | GGTTTGGGGCAGGGCAGGAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122694429_1122694441 | 6 | Left | 1122694429 | 14:103545891-103545913 | CCCAGAGGTGCTCTCAGAAGGCA | No data | ||
Right | 1122694441 | 14:103545920-103545942 | GGTTTGGGGCAGGGCAGGAGTGG | No data | ||||
1122694430_1122694441 | 5 | Left | 1122694430 | 14:103545892-103545914 | CCAGAGGTGCTCTCAGAAGGCAG | No data | ||
Right | 1122694441 | 14:103545920-103545942 | GGTTTGGGGCAGGGCAGGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122694441 | Original CRISPR | GGTTTGGGGCAGGGCAGGAG TGG | Intergenic | ||