ID: 1122694443

View in Genome Browser
Species Human (GRCh38)
Location 14:103545931-103545953
Sequence GGGCAGGAGTGGGTACCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694429_1122694443 17 Left 1122694429 14:103545891-103545913 CCCAGAGGTGCTCTCAGAAGGCA No data
Right 1122694443 14:103545931-103545953 GGGCAGGAGTGGGTACCGAGAGG No data
1122694430_1122694443 16 Left 1122694430 14:103545892-103545914 CCAGAGGTGCTCTCAGAAGGCAG No data
Right 1122694443 14:103545931-103545953 GGGCAGGAGTGGGTACCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694443 Original CRISPR GGGCAGGAGTGGGTACCGAG AGG Intergenic