ID: 1122694530

View in Genome Browser
Species Human (GRCh38)
Location 14:103546302-103546324
Sequence GTGGTGTGGAGGCGGCTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122694514_1122694530 5 Left 1122694514 14:103546274-103546296 CCCACACCCCGCCCGCCAGCTGC No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694512_1122694530 12 Left 1122694512 14:103546267-103546289 CCACAGCCCCACACCCCGCCCGC No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694513_1122694530 6 Left 1122694513 14:103546273-103546295 CCCCACACCCCGCCCGCCAGCTG No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694517_1122694530 -2 Left 1122694517 14:103546281-103546303 CCCGCCCGCCAGCTGCCCTGTGT No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694523_1122694530 -10 Left 1122694523 14:103546289-103546311 CCAGCTGCCCTGTGTGGTGTGGA No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694511_1122694530 18 Left 1122694511 14:103546261-103546283 CCAGTGCCACAGCCCCACACCCC No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694520_1122694530 -6 Left 1122694520 14:103546285-103546307 CCCGCCAGCTGCCCTGTGTGGTG No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694518_1122694530 -3 Left 1122694518 14:103546282-103546304 CCGCCCGCCAGCTGCCCTGTGTG No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694515_1122694530 4 Left 1122694515 14:103546275-103546297 CCACACCCCGCCCGCCAGCTGCC No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694521_1122694530 -7 Left 1122694521 14:103546286-103546308 CCGCCAGCTGCCCTGTGTGGTGT No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data
1122694516_1122694530 -1 Left 1122694516 14:103546280-103546302 CCCCGCCCGCCAGCTGCCCTGTG No data
Right 1122694530 14:103546302-103546324 GTGGTGTGGAGGCGGCTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122694530 Original CRISPR GTGGTGTGGAGGCGGCTCCG GGG Intergenic
No off target data available for this crispr