ID: 1122695161

View in Genome Browser
Species Human (GRCh38)
Location 14:103548837-103548859
Sequence CTCAACACGCTGACACCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122695161_1122695169 13 Left 1122695161 14:103548837-103548859 CCCACAGGTGTCAGCGTGTTGAG No data
Right 1122695169 14:103548873-103548895 TAGGTACTGGGGATACAAGCAGG No data
1122695161_1122695170 18 Left 1122695161 14:103548837-103548859 CCCACAGGTGTCAGCGTGTTGAG No data
Right 1122695170 14:103548878-103548900 ACTGGGGATACAAGCAGGAACGG No data
1122695161_1122695167 1 Left 1122695161 14:103548837-103548859 CCCACAGGTGTCAGCGTGTTGAG No data
Right 1122695167 14:103548861-103548883 CAGGTGCTGCTCTAGGTACTGGG No data
1122695161_1122695164 -6 Left 1122695161 14:103548837-103548859 CCCACAGGTGTCAGCGTGTTGAG No data
Right 1122695164 14:103548854-103548876 GTTGAGCCAGGTGCTGCTCTAGG No data
1122695161_1122695168 2 Left 1122695161 14:103548837-103548859 CCCACAGGTGTCAGCGTGTTGAG No data
Right 1122695168 14:103548862-103548884 AGGTGCTGCTCTAGGTACTGGGG No data
1122695161_1122695166 0 Left 1122695161 14:103548837-103548859 CCCACAGGTGTCAGCGTGTTGAG No data
Right 1122695166 14:103548860-103548882 CCAGGTGCTGCTCTAGGTACTGG No data
1122695161_1122695171 29 Left 1122695161 14:103548837-103548859 CCCACAGGTGTCAGCGTGTTGAG No data
Right 1122695171 14:103548889-103548911 AAGCAGGAACGGAACAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122695161 Original CRISPR CTCAACACGCTGACACCTGT GGG (reversed) Intergenic
No off target data available for this crispr