ID: 1122697406

View in Genome Browser
Species Human (GRCh38)
Location 14:103562753-103562775
Sequence GCGTGGCGCTGCCGGCGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122697406_1122697417 25 Left 1122697406 14:103562753-103562775 CCTAGCCGCCGGCAGCGCCACGC 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1122697417 14:103562801-103562823 GCCTGGAGTGACCGCGACCAAGG 0: 1
1: 0
2: 0
3: 9
4: 59
1122697406_1122697416 8 Left 1122697406 14:103562753-103562775 CCTAGCCGCCGGCAGCGCCACGC 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1122697416 14:103562784-103562806 AGCGGCGCAGCGAGGCAGCCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1122697406_1122697409 -10 Left 1122697406 14:103562753-103562775 CCTAGCCGCCGGCAGCGCCACGC 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1122697409 14:103562766-103562788 AGCGCCACGCCCACCGCCAGCGG 0: 1
1: 0
2: 0
3: 8
4: 95
1122697406_1122697413 0 Left 1122697406 14:103562753-103562775 CCTAGCCGCCGGCAGCGCCACGC 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1122697413 14:103562776-103562798 CCACCGCCAGCGGCGCAGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1122697406_1122697419 30 Left 1122697406 14:103562753-103562775 CCTAGCCGCCGGCAGCGCCACGC 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1122697419 14:103562806-103562828 GAGTGACCGCGACCAAGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122697406 Original CRISPR GCGTGGCGCTGCCGGCGGCT AGG (reversed) Intronic
900314613 1:2050598-2050620 GCGCAGCGCTGACGGCGGCGGGG + Exonic
901152333 1:7112172-7112194 GCGTAGAGCTGCTGGCTGCTGGG + Intronic
901361324 1:8703282-8703304 GCGGGGCCCCGCCCGCGGCTAGG + Intronic
901506672 1:9689698-9689720 GGGTGTCGCTGCCGGGGGCGGGG - Intronic
903002898 1:20279058-20279080 GCCTGGGGCTGCCGCCAGCTGGG + Intergenic
903216570 1:21846582-21846604 GCATGGAGCTGCCAGGGGCTGGG + Exonic
906326680 1:44850514-44850536 GCGTGGCACTGCCAGCAGCTAGG + Intronic
908140973 1:61184306-61184328 GCTTGGCACTGCCGGCTGATTGG - Intronic
910430069 1:87151625-87151647 GCGTGGCGCTCCCAGCGACCAGG - Intronic
912685202 1:111756341-111756363 GCAGGGCCCTGCCGGGGGCTAGG + Intronic
915165722 1:153946727-153946749 GGGTCGGGCTGCAGGCGGCTGGG - Intergenic
915246386 1:154558733-154558755 GCGCGCGGCTTCCGGCGGCTGGG - Intronic
915441973 1:155951058-155951080 CTACGGCGCTGCCGGCGGCTAGG - Exonic
916179145 1:162069540-162069562 GCGTCGCGCGGCCGGGGGCGCGG + Intergenic
921189861 1:212699726-212699748 GCAGGACGCTGCCGGCGGCCGGG + Exonic
1064645325 10:17454124-17454146 GCGGGGCGCGGCCGGCGGGTGGG + Intronic
1066221198 10:33336804-33336826 GCCCGGCGCAGCCGGGGGCTGGG - Intergenic
1069019128 10:63465945-63465967 GCGGCGCGGTGGCGGCGGCTGGG - Intergenic
1069574555 10:69517381-69517403 GCAAGGAGCTGCCGGGGGCTCGG + Intergenic
1070290669 10:75111523-75111545 GCGCGGCGGTGACGGCGGCCGGG + Intronic
1072930674 10:99659478-99659500 ACGTGGCGCCGCCGCCGGCCGGG + Intergenic
1075960356 10:126562930-126562952 GCATGCCACTGCCGGTGGCTGGG - Intronic
1076776394 10:132700263-132700285 GCGTGTCGCTGTCTGCGGCCTGG + Intronic
1081873150 11:46392186-46392208 GCGTGGCCCCGCTGGCGGTTTGG + Intergenic
1083747742 11:64744927-64744949 GGGTGGCGCAGCCGGCGGTGCGG - Intronic
1084267051 11:68010486-68010508 GAGTGCAGCTGCCGGTGGCTAGG - Intronic
1084363663 11:68684590-68684612 GCATGGCGCGGCCGGCAGCAGGG - Exonic
1084658963 11:70536074-70536096 GCATGGTGCTGTCGGTGGCTGGG - Intronic
1086666569 11:89491243-89491265 GCGCGGCGGGGCCGGCGGCATGG - Exonic
1089207049 11:116772823-116772845 GCCTGGCGGGGCCGGCGGCAAGG - Exonic
1089346977 11:117796967-117796989 GGGTGGCGCGGCTGGCGGCGAGG - Intronic
1091047265 11:132335577-132335599 GCGTGGCGCTGCGGGCACTTTGG + Exonic
1091259708 11:134224693-134224715 GCGTTGCACCGCCGGAGGCTGGG + Exonic
1091604244 12:1936581-1936603 GACTGGCACTCCCGGCGGCTGGG - Intergenic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1092385327 12:8032578-8032600 GCTCGGCGCTGCCCGCGGCTCGG + Intergenic
1095954165 12:47797031-47797053 GCGGGCCGCCGCCGGAGGCTGGG + Exonic
1098426048 12:70366503-70366525 GCGGGGCCCAGGCGGCGGCTGGG + Exonic
1101612190 12:106302465-106302487 GCCGGGCGCTCCCGTCGGCTCGG + Intronic
1102973478 12:117189957-117189979 GGGTGACGCTGGCGGCGGCGCGG - Intronic
1103614838 12:122145530-122145552 GACTGGCCCTGCCGGCAGCTGGG + Exonic
1105557243 13:21459006-21459028 GCGGGGCGCGGGCCGCGGCTAGG - Intronic
1107976581 13:45694093-45694115 GCGTGGCTCTGCCAGCACCTTGG + Intergenic
1110005032 13:70255509-70255531 GGGTGTCACTGCCGGCAGCTCGG - Intergenic
1111940479 13:94601872-94601894 GCGGGCAGCCGCCGGCGGCTGGG + Intergenic
1112629789 13:101148214-101148236 GCATGGCCCTGCTGGCGCCTTGG - Intronic
1113541771 13:111115145-111115167 GCGGGGCGGCGGCGGCGGCTGGG - Intronic
1114031404 14:18583803-18583825 GCTTCGCGCTGCCGCCAGCTGGG + Intergenic
1115235663 14:31207200-31207222 CCGGGGCCCTGCCGGCGGCGGGG - Exonic
1116019346 14:39441861-39441883 GCGTGTCACTGCCTGCAGCTTGG - Intergenic
1119675145 14:76547850-76547872 GCGTGGGGCTGTGGCCGGCTGGG - Intergenic
1121342774 14:93115328-93115350 GCGGGGCGCGGCGGGCGGCCGGG + Intronic
1122697406 14:103562753-103562775 GCGTGGCGCTGCCGGCGGCTAGG - Intronic
1123711563 15:22991516-22991538 GGGAGGCGCTGGCGGAGGCTTGG + Intronic
1124098450 15:26670524-26670546 GCGTGGAGCTGCGGTCGGCACGG - Intronic
1124427047 15:29570949-29570971 GCGCGGCGCGGCCGGCGGGCGGG - Intergenic
1129701094 15:77769104-77769126 GCGTGGTGCTGGCTGCGGCCAGG - Intronic
1131271999 15:90953238-90953260 GCGGGCAGCTGCCGGGGGCTTGG + Exonic
1134042284 16:11077747-11077769 GCGTGGTGCTGCAGGCGGCCTGG + Intronic
1141316620 16:82968478-82968500 TCATGGCCCTGCCAGCGGCTTGG + Intronic
1141964754 16:87434374-87434396 GCGTGGGGCTCCTGGCGCCTGGG - Intronic
1142062223 16:88038042-88038064 GCGTTGCGCTGCCGAGGGATGGG + Intronic
1142388674 16:89783704-89783726 GCATGGAGCTGCAGGCGGCCGGG - Intronic
1143367672 17:6418911-6418933 GTGTGGCTCTGCAGGAGGCTTGG - Intronic
1145077316 17:19867129-19867151 GCGGAGCGCTGCCAGAGGCTTGG + Intronic
1145163113 17:20589132-20589154 GCCTGCCGCTGACGGCGGCGGGG + Intergenic
1146907525 17:36627315-36627337 GACTGGCCCTGCAGGCGGCTGGG - Intergenic
1147996154 17:44361541-44361563 GCGTGGCGCTGGCTGCGGATTGG - Intronic
1149263107 17:54900530-54900552 GAGTGGCGCGGCCGCCCGCTCGG - Exonic
1149626519 17:58083918-58083940 TCGTGGCGCTGCTGGAGGCCCGG + Intronic
1153457268 18:5295390-5295412 GCGCGGCGGGGCCCGCGGCTCGG + Intronic
1153900677 18:9614671-9614693 GCGGGGCGCGGCCGGGGGCCCGG - Intronic
1156448565 18:37253984-37254006 CCGGGGCGCTGCCGGCGGGGAGG + Intronic
1158893458 18:61893836-61893858 GAGCGGCGCTGTCGGCTGCTCGG - Intronic
1160025032 18:75209540-75209562 GCCCGGGGCTGCCGCCGGCTCGG - Intergenic
1160355797 18:78227485-78227507 GCCTGGAGGTGCTGGCGGCTGGG - Intergenic
1160747611 19:719401-719423 GTGTGGCGGTGTGGGCGGCTCGG - Intronic
1161340451 19:3739031-3739053 GCGTGGCTCTGCCCGGGGCCGGG - Exonic
1162031830 19:7920809-7920831 GCGGGGCGATGCCGGGGGCGGGG + Intronic
1162374433 19:10296378-10296400 GCGCGGCGCTGCTGGCCGCGGGG + Exonic
1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG + Intergenic
1163579858 19:18131904-18131926 GCGTGGCGCAGTCGCCGCCTGGG - Exonic
1164907703 19:31981048-31981070 GCGTGGCGCTCCGTGTGGCTTGG - Intergenic
1165112127 19:33508592-33508614 GGCTGGTGCTGCTGGCGGCTGGG + Intronic
1166300123 19:41908378-41908400 GCCTGGCGCTGCCAGGGGCTGGG - Intronic
1167090653 19:47341481-47341503 GCCCGACGCTGCCGGCCGCTGGG + Exonic
1167103795 19:47419220-47419242 GCCTGCCGCTGACGGCGGCGGGG - Exonic
1167309538 19:48729068-48729090 GCGCGCCGCAGCCGCCGGCTCGG - Exonic
1168072999 19:53963070-53963092 GCGGGGCCGTGCCGGCGGCTGGG - Exonic
1168154013 19:54463353-54463375 GCGAGGCGCAGCCGGAGGCCGGG - Exonic
1168459084 19:56538854-56538876 GCGGGGCGCGGCCGGGGGCGGGG + Intergenic
929033666 2:37671694-37671716 GCGGGGCGGGGCCGGCGGCGCGG + Exonic
929133655 2:38602704-38602726 AAGAGGCGCTGCCGGCGGCGAGG - Exonic
938496796 2:131801993-131802015 GCTTCGCGCTGCCGCCGGCTGGG - Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
945988244 2:216371687-216371709 GCGTGGGGGTGGGGGCGGCTGGG + Exonic
948634580 2:239327163-239327185 GCCTGGCTCTGCTGGCAGCTGGG + Intronic
1168954907 20:1828035-1828057 GGGTGGGGCGGCCGGTGGCTGGG + Intergenic
1170889886 20:20368136-20368158 GCGTGGCGCCGGCGACGGCTCGG - Exonic
1175119579 20:56707780-56707802 GCATGGCTCTGCCGGCACCTTGG - Intergenic
1175716038 20:61254249-61254271 GCGGGAGGCTGCCGGTGGCTGGG - Intronic
1176005629 20:62861062-62861084 GCGCGGCGCGGGCGGCGGCTCGG + Exonic
1179880077 21:44289876-44289898 GAGTGGCTCTGCTGGGGGCTGGG + Intronic
1179971637 21:44839076-44839098 GTGTGGTGCTGGCTGCGGCTGGG + Intergenic
1180455517 22:15510860-15510882 GCTTCGCGCTGCCGCCAGCTGGG + Intergenic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1182083507 22:27545485-27545507 GGGTGGGGCTGCCAGGGGCTGGG - Intergenic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1185370495 22:50458788-50458810 GCCTGGCTCTGCCTGCAGCTTGG - Intronic
950125047 3:10505692-10505714 CCCTGCCGCTGCCGGAGGCTGGG + Intronic
950487791 3:13283054-13283076 GCGCGGCGGGGACGGCGGCTCGG + Intergenic
950524810 3:13517526-13517548 GGGTGGGGCTGCCGGGGGCTGGG - Intergenic
952451760 3:33440054-33440076 GGGTGGCGCTGCCGGCGGCCCGG - Exonic
959484653 3:106913218-106913240 GCGTGTCACTGCCCGCAGCTCGG - Intergenic
965774120 3:172210183-172210205 TCGTGGAGCTGGCGGGGGCTGGG - Intronic
968635459 4:1676194-1676216 GCATGGCCCTGCTGGCGTCTTGG - Intronic
968661728 4:1801449-1801471 GAGTGGGGTTGCCAGCGGCTGGG - Exonic
968775435 4:2536963-2536985 GCGGGGCGGCGGCGGCGGCTCGG + Intronic
968850405 4:3074308-3074330 GCGTGGCGATGCGGGGGGCGTGG - Intergenic
968850411 4:3074325-3074347 GCGTGGCGATGCGGGGGGCGTGG - Intergenic
968980909 4:3848899-3848921 GCGTGGAGCTGGCGGGGGCCAGG - Intergenic
969413335 4:7043411-7043433 GGCTGGCTCTGGCGGCGGCTGGG + Exonic
969521476 4:7680313-7680335 GAGAGGAGCTGCCGGCGGCTGGG - Intronic
970967885 4:21948880-21948902 GCGCGAAGCTGCCGGCGCCTCGG - Intergenic
971279826 4:25233986-25234008 GTGGGGCGCGGCCGGCGGCGAGG + Exonic
975585053 4:75940845-75940867 GCGCGGCGCTGCTGGGGGCGAGG + Exonic
976704614 4:88007777-88007799 GCGGGGCGCGGGCGGCCGCTTGG - Exonic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
981475088 4:145180051-145180073 GCCTGGGGCAGGCGGCGGCTCGG + Intronic
982443209 4:155460615-155460637 GCATAGCAATGCCGGCGGCTAGG + Intergenic
983920040 4:173334784-173334806 GCTTGGCGACGGCGGCGGCTCGG + Exonic
985437057 4:189940674-189940696 GCGCGGTGCTGACGGTGGCTGGG - Intergenic
992796079 5:80256098-80256120 GCGAGGCGGGGCCGGCGGCGGGG - Intergenic
996407937 5:123125156-123125178 GTGTGGCGGGGCCGGCGGGTGGG - Intronic
997429946 5:133830632-133830654 GCATGGCCCTGCCTGAGGCTCGG - Intergenic
997584061 5:135034355-135034377 GCGCGGCGGCGCGGGCGGCTTGG - Intronic
998349598 5:141492063-141492085 GCGTGCCGGAGCCGGCGCCTAGG - Intronic
1000220447 5:159209257-159209279 GAGCGGCGCTGCCGGCGGGCGGG + Intronic
1001470224 5:172006626-172006648 GGGCGGAGCTGCCGGCGGCCCGG - Exonic
1001803587 5:174564513-174564535 CCGTGGCGATGCCTGCAGCTAGG - Intergenic
1002579337 5:180198206-180198228 GGGTGGCGCTGTCTGGGGCTGGG - Intronic
1002638328 5:180618983-180619005 GCGGGGCGCCGCGGGCGGCGGGG - Intronic
1010569965 6:77464126-77464148 GGGTGGCGGTGGCGGCGGCGCGG - Intergenic
1011277016 6:85642173-85642195 GCCTGGCGCCGCCGGTGCCTCGG - Intronic
1011734214 6:90296254-90296276 GCGCGGCGCGGCCGCCGGCTCGG + Intronic
1014272568 6:119349927-119349949 GCGGGGCCCGGCCGGCGGCGGGG + Intergenic
1016923217 6:149317067-149317089 GCGCGGCGCCGCCGGCCGCCCGG + Intronic
1019769781 7:2876448-2876470 GCGGGGCGCTGCCTGAGGCCCGG + Intergenic
1020118248 7:5488311-5488333 GCATGGCGCTACAGGCGGGTCGG - Intronic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1021992535 7:26152212-26152234 GCGCCGGGCTGCGGGCGGCTGGG + Intergenic
1026471325 7:70695385-70695407 GCGTGGCGCTGCCCGCTCCTGGG + Intronic
1026665554 7:72337213-72337235 GTGTGGTGCTGTCGGCGGCAAGG - Intronic
1029704442 7:102268690-102268712 GCGTGGCGCTGGTGTCGGTTTGG + Intronic
1034137378 7:148783272-148783294 GCGTGGCGATGCCGGGGGCCAGG - Intronic
1034946826 7:155267614-155267636 GCGTGGCCCTGCTGGCGCCTTGG - Intergenic
1034977949 7:155458806-155458828 GAGAGTCGCTGCCGGCGGCTGGG - Exonic
1035528929 8:336235-336257 GCCTGGGGCTGCCGGCTGCCAGG - Intergenic
1041194709 8:55389193-55389215 GCGTGGCCCTGCAGGCACCTTGG + Intronic
1045277436 8:100721190-100721212 GCGTGTGGCTGCCGGCAGCGCGG + Intronic
1051774937 9:20622649-20622671 GTGTGGCGCTGCGGGCCGCCGGG - Intergenic
1051867381 9:21696719-21696741 GCCGGGCGCTTCCGGCTGCTGGG - Intergenic
1052366688 9:27619912-27619934 GCGTGGGGGTCCCGGAGGCTTGG - Intergenic
1056764695 9:89437509-89437531 GCCTGTCGCTGCCGCCTGCTAGG - Intronic
1061326556 9:129868075-129868097 CGGTGGCGCTGACGGAGGCTCGG + Exonic
1061449224 9:130659677-130659699 GCGCGGGGCTGCCGGCGGAGTGG - Intergenic
1061765347 9:132878128-132878150 TCGCGACGCTGGCGGCGGCTCGG - Intronic
1062467804 9:136688842-136688864 GAGTGCCGCTGCCGGGAGCTGGG + Intergenic
1187464409 X:19515024-19515046 GGGCGGCGCGGCCGGCGGCCCGG - Exonic
1191898601 X:66018870-66018892 GCGTGGCACTGCAGGAGGCCAGG - Intergenic