ID: 1122703441

View in Genome Browser
Species Human (GRCh38)
Location 14:103605581-103605603
Sequence GCTGCTGGTGCTCCTCAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122703441_1122703451 28 Left 1122703441 14:103605581-103605603 CCAGATTGAGGAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1122703451 14:103605632-103605654 GTGTGCTGGGAACACAGTTCTGG 0: 1
1: 0
2: 2
3: 22
4: 205
1122703441_1122703446 -2 Left 1122703441 14:103605581-103605603 CCAGATTGAGGAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1122703446 14:103605602-103605624 GCCATGGGCTGGCATGTGACAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1122703441_1122703449 14 Left 1122703441 14:103605581-103605603 CCAGATTGAGGAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1122703449 14:103605618-103605640 TGACAGGCTGGTCAGTGTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 210
1122703441_1122703452 29 Left 1122703441 14:103605581-103605603 CCAGATTGAGGAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1122703452 14:103605633-103605655 TGTGCTGGGAACACAGTTCTGGG 0: 1
1: 0
2: 2
3: 38
4: 351
1122703441_1122703448 2 Left 1122703441 14:103605581-103605603 CCAGATTGAGGAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1122703448 14:103605606-103605628 TGGGCTGGCATGTGACAGGCTGG 0: 1
1: 0
2: 3
3: 19
4: 307
1122703441_1122703450 15 Left 1122703441 14:103605581-103605603 CCAGATTGAGGAGCACCAGCAGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1122703450 14:103605619-103605641 GACAGGCTGGTCAGTGTGCTGGG 0: 1
1: 0
2: 1
3: 23
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122703441 Original CRISPR GCTGCTGGTGCTCCTCAATC TGG (reversed) Intronic
902091103 1:13903932-13903954 GCTTCTGGTGCTCCTGACTGGGG - Intergenic
902241818 1:15094826-15094848 GCTGCAGGTCCTCGTCACTCAGG - Exonic
902507745 1:16948826-16948848 GCTGCCGTTGCACCTCAAACAGG - Exonic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
906301117 1:44682448-44682470 GCTGCTGCTGCTTCTAAATCAGG - Intronic
906671109 1:47655689-47655711 CCTGCTGGAGCTCCTCCAGCTGG + Intergenic
912850329 1:113118633-113118655 GCTGTTTCTGCTCCTCACTCTGG + Intronic
912898146 1:113616213-113616235 GCTGCTGTTGCTTCTAATTCAGG - Intronic
913438977 1:118877215-118877237 GCTGGTGGTGCTCCTCAGAAAGG - Intergenic
913590381 1:120319239-120319261 CCTGCTGTCGCTCCTCAAACTGG - Intergenic
913617805 1:120579124-120579146 CCTGCTGTCGCTCCTCAAACTGG + Intergenic
914572466 1:148931848-148931870 CCTGCTGTCGCTCCTCAAACTGG - Exonic
914600373 1:149198414-149198436 CCTGCTGTCGCTCCTCAAACTGG + Intergenic
918082450 1:181218030-181218052 TCTGCTGCTGCTCCTCATACAGG - Intergenic
920178328 1:204117118-204117140 GCTGCTGCTGCTTTGCAATCTGG - Exonic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
922594636 1:226804321-226804343 GATGCTGGTACTCCTCACACAGG - Intergenic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1065950332 10:30645717-30645739 GCTGCTGGCTCTGCTCCATCTGG + Intergenic
1070825135 10:79386398-79386420 GCTGCGGGTGCTCCTTGCTCTGG + Exonic
1071369784 10:84939613-84939635 GGTGCTGGTGCTGTTCAGTCAGG - Intergenic
1073731837 10:106297317-106297339 TCTGGTGGTGGTCCTCAACCTGG + Intergenic
1074913225 10:117931189-117931211 GCAGATGGTCCTCCTCAATTTGG - Intergenic
1075575448 10:123574083-123574105 GATGTTGGTACTCCTCCATCTGG - Intergenic
1076745016 10:132508552-132508574 CCTGCTGCTGCTCCTAAATGGGG + Intergenic
1077411821 11:2407218-2407240 GCTCGTGGTACTCCACAATCAGG + Exonic
1077469158 11:2748703-2748725 GCTGCTGCTGCCCCTCCCTCTGG + Intronic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083717195 11:64584196-64584218 GCTGCTGGTGCCCCTCGGTGGGG - Intergenic
1084151661 11:67290362-67290384 GCAGCTGGTGCTCCAGTATCGGG + Exonic
1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG + Intergenic
1086955598 11:92931855-92931877 GCTGCTGGTGATCCTACAGCTGG + Intergenic
1087269058 11:96092668-96092690 GCTGCTGGTGCTGCTGCATCCGG + Exonic
1090999259 11:131894676-131894698 GCTGCTGGTGGTTTGCAATCTGG - Intronic
1095601176 12:44014498-44014520 GATGCTGATGCTCCTAAATCTGG + Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096094494 12:48925368-48925390 GCTGCTGCTGCTGCTCAGTGCGG - Exonic
1098765431 12:74482596-74482618 GCAGCTGGTGATCCACAGTCAGG - Intergenic
1101797659 12:107990621-107990643 GCTGCTGGGGCTCCTAAACTAGG + Intergenic
1104722405 12:131052170-131052192 GCTGCTGCTGCTCCACAAATTGG + Intronic
1106953772 13:34913166-34913188 GCTGCTGCTGCTACTGAAGCCGG + Intergenic
1107609936 13:42103023-42103045 CCTGCTGCTTCTCTTCAATCAGG - Intronic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1112220884 13:97488579-97488601 TCTGCTAGTGGTTCTCAATCAGG + Intergenic
1112622399 13:101065764-101065786 TCTGCTGGTGCTTCTCTTTCTGG + Intronic
1113200789 13:107866374-107866396 GCTGCTGGTGCTCCTTGTCCCGG + Exonic
1113785819 13:113001694-113001716 GCCGATGCTGCTCCTTAATCAGG + Intronic
1119545590 14:75469331-75469353 CCTGCTTCAGCTCCTCAATCTGG - Exonic
1119951661 14:78751781-78751803 GCTACTGCTGCTCCTCCAGCAGG - Intronic
1120355028 14:83421591-83421613 GCTGTTTCTGCTCCTCAAACCGG - Intergenic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1122937948 14:104968490-104968512 GCTGGTGGGAGTCCTCAATCTGG - Intronic
1125734884 15:41917966-41917988 GCTGCTGCTGCCCCTCACACAGG - Intronic
1128516657 15:68346255-68346277 GCTCCTGGGTCTCCTCACTCTGG + Intronic
1131537125 15:93246696-93246718 TCAGCTGGTGTTCCTGAATCAGG + Intergenic
1133216200 16:4293966-4293988 GCTGCTGCTGCTGCTGAAGCCGG - Intergenic
1135294249 16:21265356-21265378 GCTGCTCTTCCTCCTCATTCAGG + Intronic
1135480696 16:22818535-22818557 GCTGCTGCTGTTACTAAATCGGG + Intronic
1138182640 16:54952521-54952543 GCTCCTCGTTGTCCTCAATCTGG - Intergenic
1138410911 16:56839535-56839557 GAAGCTGGTGCCCCTGAATCAGG + Exonic
1139593801 16:67947077-67947099 GCTGCTGGTGCTGCTGAAGCTGG - Exonic
1140450387 16:75065906-75065928 GCCGCTGCTGCTCCTCTCTCAGG + Intronic
1141463146 16:84190146-84190168 GCTGCTGCTGCTGCTGAAGCTGG - Intergenic
1141642838 16:85351287-85351309 GCTGCTGTGGGTCCTCAAACTGG + Intergenic
1145289791 17:21534137-21534159 TCTGCTGGTGTTCCTCCATGGGG - Exonic
1146054072 17:29572585-29572607 CCTGCTGGTGCTGCTCACCCTGG + Exonic
1147969325 17:44211128-44211150 GCTGCTGCTCCTCCTCAGGCAGG + Exonic
1151651846 17:75475137-75475159 GATGCTGCTGCTCTGCAATCTGG - Intronic
1152016848 17:77756452-77756474 TCTGCTGGGGCCCCTCCATCTGG + Intergenic
1152695500 17:81741838-81741860 GCAGCAGGTGTTCCCCAATCAGG - Intergenic
1154359822 18:13650260-13650282 GCTGCTGCTGCTTCTCGAACTGG + Exonic
1156470232 18:37373236-37373258 ACTGCTGGTTCCCATCAATCAGG + Intronic
1161062092 19:2220261-2220283 GCTGCTGCTGCTCTTCAGGCAGG + Intronic
1162150702 19:8643517-8643539 GCAGATGGTGCTCCCCAATGTGG + Intergenic
1162191982 19:8954123-8954145 GGTGCTGGTCTCCCTCAATCTGG + Exonic
1163148918 19:15399831-15399853 CCTGCTGGCGCTCATCACTCAGG + Intronic
1165377123 19:35450575-35450597 GCTGCAGGTGCTGCGGAATCAGG + Exonic
1167070602 19:47220096-47220118 GCTCCAGGTGCTCCTCCAGCTGG + Intergenic
1168139533 19:54375972-54375994 GCAGTTGGAGCTCCTCCATCAGG + Intergenic
1168158410 19:54491818-54491840 GCAGTTGGAGCTCCTCCATCAGG - Intergenic
926786209 2:16521008-16521030 GCTTCTGCTGCTGCACAATCTGG + Intergenic
929438347 2:41946206-41946228 GCTCATGTTGCTCCTCCATCTGG - Intronic
930051355 2:47218539-47218561 GCTGCTGGTTCCCCTCCATCAGG + Intergenic
930233482 2:48866254-48866276 GCTGCTGCTGCTCCTGACTGTGG + Intergenic
933476183 2:82793597-82793619 TCTGCTGATTCTCCTCTATCAGG + Intergenic
933776375 2:85773622-85773644 GCTGCTGGGGCTTCTGGATCTGG - Intronic
934762349 2:96863726-96863748 ACAGCTGCAGCTCCTCAATCAGG + Exonic
935360560 2:102243265-102243287 GCTGCTGGTGATTCTCAGTAGGG + Intergenic
935623046 2:105145150-105145172 GCTGTGGGAGCTCCTCAATCTGG + Intergenic
937644419 2:124250291-124250313 GCTGCTGGTGCTCCTGGTTGGGG + Intronic
937744468 2:125395285-125395307 GCTGCAGGTGATTCTAAATCTGG - Intergenic
937908025 2:127061833-127061855 GATGCTCGTGCTCCACAATGAGG + Intronic
941514279 2:166452811-166452833 GCAGCTGGAACTCCTCAATAAGG + Intronic
945906687 2:215601776-215601798 GCTGCTAGTGCTTCTACATCTGG - Intergenic
948405651 2:237716820-237716842 GCTACTGCTGCCACTCAATCAGG - Intronic
948617944 2:239213485-239213507 GCTGCTGTTGCTACTGCATCTGG + Intronic
1171366704 20:24629820-24629842 GCTGCCTGGGCTCCTCACTCTGG - Intronic
1175234644 20:57501655-57501677 GCTCCTGGGGCTTCTCCATCCGG - Intronic
1175678155 20:60965038-60965060 GCTGCTGGGGCTGCTAAAGCGGG - Intergenic
1176861095 21:14011993-14012015 GCGACTCGTGCTCCTCACTCAGG + Intergenic
1179969689 21:44827862-44827884 CCTGTTGGTGCCCCTCACTCAGG - Intergenic
1180551240 22:16543663-16543685 GGTTTTGGTGCTCCTCAAGCAGG - Intergenic
1181182134 22:21075769-21075791 GCTGCGGCTGCTTCTCAAGCAGG - Intergenic
1183028449 22:35084137-35084159 GCAGCTGGTGCTGCCCAATTGGG - Intronic
1184556782 22:45237487-45237509 GCTCCTGGCCCTCCTCACTCAGG - Intronic
1184769367 22:46588696-46588718 GGTGCTGGGGCTCCTGGATCAGG - Intronic
1184801314 22:46762264-46762286 GCTGCGGGTGCTGGTCAAGCTGG - Intergenic
1185188416 22:49417394-49417416 GCTTCTGATGCACCTCATTCTGG + Intronic
949465628 3:4340224-4340246 GATGCTGATGCTGCTGAATCCGG + Intronic
949627349 3:5881732-5881754 GCTGCTTTAGCTCCTCAATCAGG - Intergenic
951743980 3:25956393-25956415 GTTGCTTGTGCCCTTCAATCTGG - Intergenic
953875035 3:46661885-46661907 GCAGCTGTTGCTCCTCAGTGTGG - Intergenic
954287286 3:49627971-49627993 GCTGCTGGACCTCCTCAACCAGG - Intronic
954698992 3:52441944-52441966 GCTGCTGGTGCTTCTCTCCCAGG - Intronic
954700782 3:52449884-52449906 GCTGCTGGTGCTGCCCGATGTGG + Intergenic
954757990 3:52852509-52852531 GCTGCTGGTCCTGCTCCCTCTGG - Intronic
956313887 3:67913203-67913225 GCTGGTGGGGTTCCTCAATGTGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
963308427 3:143679985-143680007 GCTGGAGGAGTTCCTCAATCAGG - Intronic
963969722 3:151416308-151416330 GCTGCTGGGGCTGCTGCATCTGG - Exonic
964499315 3:157330988-157331010 GCTGCTAGTGCTCTCCTATCCGG + Intronic
968698103 4:2042405-2042427 GCTGCTGCTGCTGCTGAGTCTGG + Exonic
969494006 4:7515519-7515541 GCTGCTCCTCCTCCTCCATCCGG - Intronic
969530680 4:7728644-7728666 GCTGCAGGTCCTCCTAAATAAGG - Intronic
969687234 4:8682471-8682493 GGTGCTGCTGCTTCTCAATGTGG - Intergenic
974011924 4:56614960-56614982 GCTTCTGGGGCTCCTCATTTAGG - Intergenic
975328308 4:73085317-73085339 GCTGCGGGTGCTCCTCCAAGGGG + Exonic
976984630 4:91278348-91278370 GTATCTGGTGCTCCTCTATCAGG + Intronic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
983216509 4:165007435-165007457 GCTGCTGGTGCATATAAATCTGG + Intergenic
986018543 5:3779552-3779574 GCTGCTGTGGCTCCCCACTCCGG - Intergenic
986297909 5:6454986-6455008 GCTGCTGGAGCTCTCCAAGCGGG - Intronic
986350910 5:6878598-6878620 GCTGCTGGTGCTGTTGCATCTGG - Intergenic
986399861 5:7370272-7370294 GCTTCTGGAGCTCATCACTCCGG - Intergenic
987048417 5:14128767-14128789 ATTGCTGGGCCTCCTCAATCTGG - Intergenic
993711201 5:91227155-91227177 TATGCTGGTGATCCTCAACCTGG + Intergenic
994320938 5:98393392-98393414 GCTGCTGCTGCTGCCCACTCAGG + Intergenic
998360729 5:141584192-141584214 GTTGCTGTTTCTCCTCATTCAGG + Exonic
1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG + Intergenic
1019308964 7:349684-349706 CCTGCTGGTGTCCCTGAATCTGG - Intergenic
1020013462 7:4818397-4818419 GCTCCTGGTGCTCCTCCTTCAGG + Intronic
1020246818 7:6435754-6435776 GTTGCGTGTGCTCCTCAATCCGG - Intronic
1021121401 7:16799746-16799768 GCAGTTTGTCCTCCTCAATCTGG - Exonic
1024386791 7:48761411-48761433 GCTTCTGGTGCTCATATATCTGG - Intergenic
1024770216 7:52713479-52713501 GAAGCTGGTGCTCCCCAAACTGG - Intergenic
1026160119 7:67861273-67861295 TCAGCTGGTGTTTCTCAATCTGG + Intergenic
1028117292 7:87013535-87013557 CCTGCTGGTACTTCTCAATGTGG - Intronic
1030495184 7:110289829-110289851 GCTGCTGGTGCTGCTAGTTCAGG - Intergenic
1032282243 7:130513450-130513472 TCTTCTGGTGTTCCTCATTCTGG - Intronic
1032657574 7:133948182-133948204 GCTGATTGTGCTATTCAATCTGG + Intronic
1033524001 7:142192175-142192197 GCCCCTGGTGTTCCACAATCAGG + Intronic
1035495617 7:159323056-159323078 ACTGGTGCTGCTCCTCCATCTGG - Intergenic
1038542347 8:28400561-28400583 TCTGCTGGTGCTGCTAAATTAGG - Intronic
1039804297 8:40985292-40985314 CCTGCTGATCCTCCTCAAGCGGG + Intergenic
1044055096 8:87558865-87558887 GTTGCTTTTTCTCCTCAATCTGG + Intronic
1044629269 8:94262998-94263020 AATGCTGAGGCTCCTCAATCAGG + Intergenic
1045565354 8:103309207-103309229 GATGCTGATGCTGCTCACTCAGG + Intronic
1048306281 8:133286975-133286997 GCTGCTGGCGGTCCACCATCTGG + Intronic
1057440567 9:95080055-95080077 GCTGCTGGTGCTCCTTCCTCAGG - Intronic
1058241606 9:102569213-102569235 TCTGCTGTTGCTTCTCATTCTGG - Intergenic
1060052790 9:120389040-120389062 GGTGCAGGTGCTCCACAAACGGG - Exonic
1060960357 9:127676451-127676473 GCTGCTGATGGTCCTCACTCAGG + Intronic
1061042505 9:128148305-128148327 GCTGCTTGGGATCCCCAATCTGG - Intergenic
1061597697 9:131642812-131642834 CCTGCTGGTGCTCTTCAGTCTGG + Intronic
1061648438 9:132026141-132026163 GCTGCTGCTGCTCCTCATTTTGG - Intronic
1062598307 9:137308996-137309018 GCTCCTGGTCATCCTCAGTCGGG - Intronic
1187675237 X:21709940-21709962 GCAGATGGTGCTTCTCAGTCTGG - Intronic
1187685880 X:21815070-21815092 CCTGCTGGGGCTCCTCCCTCTGG + Intergenic
1187940702 X:24378068-24378090 GCTGCTGCTGCTGCTGGATCAGG + Intergenic
1188024890 X:25197936-25197958 GCTGCTGATGCTCCTCCAGTTGG - Intergenic
1191782736 X:64886001-64886023 GGGACTGGTGTTCCTCAATCTGG - Intergenic
1196116000 X:112000160-112000182 TCTGCTGGTGATTCTAAATCTGG - Intronic
1196157616 X:112448452-112448474 GCTGCTGGTTTTCTGCAATCTGG - Intergenic
1199496306 X:148456409-148456431 AATGCTGGTGCTCTTCAGTCTGG - Intergenic
1199814699 X:151387102-151387124 GCAGCTGGTGCTTCACCATCTGG + Intergenic