ID: 1122706305

View in Genome Browser
Species Human (GRCh38)
Location 14:103624273-103624295
Sequence CAACCAGGGCTTGCTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122706300_1122706305 0 Left 1122706300 14:103624250-103624272 CCATGTGAGGAAACCAGCTACCA 0: 1
1: 0
2: 1
3: 18
4: 170
Right 1122706305 14:103624273-103624295 CAACCAGGGCTTGCTGAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1122706299_1122706305 5 Left 1122706299 14:103624245-103624267 CCAGGCCATGTGAGGAAACCAGC 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1122706305 14:103624273-103624295 CAACCAGGGCTTGCTGAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122706305 Original CRISPR CAACCAGGGCTTGCTGAGAC AGG Intronic
900371041 1:2332324-2332346 TCACCAGGGTGTGCTGAGACCGG - Intronic
904294151 1:29506943-29506965 CCCCCAGTGCGTGCTGAGACAGG + Intergenic
904680347 1:32224780-32224802 CTACTGGGGCTGGCTGAGACAGG - Intronic
904924604 1:34037543-34037565 CAACCAGCGCTTGCTAGGATGGG - Intronic
905125941 1:35716287-35716309 CAGCCAGGGCTAGCTGAGGGGGG - Exonic
905142095 1:35855468-35855490 CCACCTGTGTTTGCTGAGACTGG + Exonic
905974915 1:42167904-42167926 GAGCCGGGGCTTGCGGAGACCGG + Intergenic
907107992 1:51901522-51901544 AAAAAAGGGCTTGCTGGGACCGG + Intergenic
908792430 1:67796323-67796345 CAACCATTCCCTGCTGAGACTGG + Intronic
909665007 1:78122764-78122786 CAATATGTGCTTGCTGAGACAGG + Intronic
910876954 1:91886434-91886456 CAACCCGGGCACGCTGAGCCCGG - Intronic
913117698 1:115712046-115712068 CAACAAGGTCTTTCTGAGAGAGG - Intronic
915239066 1:154506972-154506994 AGACCAGGGCATGGTGAGACAGG - Intronic
918987077 1:191645495-191645517 CAATCAGAGCTTGGTGACACAGG + Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919570587 1:199243119-199243141 CTGCCAGGGCTTGTTGAGGCAGG + Intergenic
922499091 1:226083660-226083682 CAGCCAGGGCTGGCGGAGAAGGG - Intergenic
1062897909 10:1118502-1118524 CAACCAGAGCTGGCTGAGGGTGG - Intronic
1063600672 10:7477865-7477887 CAGCCAGAACTTACTGAGACAGG + Intergenic
1065816628 10:29488381-29488403 CCACCAGGGCTTCCAGAGGCAGG - Intronic
1065956232 10:30696275-30696297 CCACCAGGGCTTCCAGAGGCAGG + Intergenic
1067209333 10:44245889-44245911 AGACCAGGGCTTCCTGGGACTGG + Intergenic
1070702032 10:78610974-78610996 ACACCAGGGCTTGCTGGGTCAGG - Intergenic
1071812996 10:89203991-89204013 CTCCCAGGGCTTGCTTAGACTGG + Intergenic
1071827546 10:89340207-89340229 CAACCTGGGATTGCTGAGCAGGG + Exonic
1073102661 10:101014928-101014950 CACACAGGCCTTCCTGAGACAGG + Intronic
1074728344 10:116339062-116339084 CCACCAGAGCTTACTGAGAAGGG - Intronic
1075789166 10:125071166-125071188 CAACCACCGCCTGCTGAGAGGGG + Intronic
1076742420 10:132493309-132493331 CCCCCAGGGCCTGCTGAGTCTGG + Intergenic
1077675357 11:4189899-4189921 CAACCAGGCCTAGGTGAGGCAGG + Intergenic
1078507145 11:11960717-11960739 CACACAGGGCTTGCTGAAAGTGG - Intergenic
1078523794 11:12085448-12085470 CAATCAGGGATGGCTGAGTCAGG - Intergenic
1080210783 11:29782411-29782433 CTACCAGGGTTGGCTGAAACAGG - Intergenic
1083270238 11:61568580-61568602 CAGCCAGCGAGTGCTGAGACGGG + Intronic
1083991045 11:66245974-66245996 CATCCAGAGCTTGCTGTCACTGG + Intergenic
1084785341 11:71438676-71438698 CTCCCAGGGCTGGCAGAGACAGG + Intronic
1097604522 12:61736088-61736110 AAGCCAGGGATTGCTGAGAAGGG - Intronic
1098092955 12:66923674-66923696 CAACCAGGTCTTTCTGAATCTGG - Intergenic
1102882132 12:116493709-116493731 CAGCCAGGTCTTGCTGAGAGTGG - Intergenic
1103331633 12:120158363-120158385 CACCCAGGGCCTCCTGAGCCTGG - Intronic
1103912489 12:124360086-124360108 CAGCCAGGTCCTGCTGAGCCAGG - Intronic
1104837217 12:131799472-131799494 AAACCAGCGCTTCCTGAGACGGG + Exonic
1107188432 13:37550241-37550263 CATCCAGGTCATGCTGATACAGG - Intergenic
1107838785 13:44435126-44435148 CAAGTAAGGCTTCCTGAGACTGG + Intronic
1118470201 14:66068154-66068176 CAACAAGTCTTTGCTGAGACAGG + Intergenic
1118798935 14:69171627-69171649 CAACCAGGTCTCTCTGAGGCAGG + Intergenic
1121288167 14:92752686-92752708 CAACCAGAGGTTAGTGAGACTGG + Intergenic
1122493111 14:102133448-102133470 TACCCAGGGCTTGGTGAGAATGG + Intronic
1122706305 14:103624273-103624295 CAACCAGGGCTTGCTGAGACAGG + Intronic
1122921369 14:104881759-104881781 CACCCAGGGGCTGCTGAGGCAGG - Intronic
1125975701 15:43949541-43949563 CAAGCAGGACTTTCAGAGACTGG - Intronic
1127277169 15:57457402-57457424 CAACCAGAGCCTGAAGAGACAGG - Intronic
1128069685 15:64787140-64787162 CAACCAGGGTTTGAGGTGACAGG - Intergenic
1129298249 15:74611461-74611483 GCACCAGGGCTTGCTCCGACAGG + Intronic
1129333319 15:74838670-74838692 CAATCAGGCCCTGCTGAGGCAGG - Exonic
1129902464 15:79161385-79161407 CATCTAGGGCCTACTGAGACTGG - Intergenic
1132676819 16:1124440-1124462 CAACCAGGGCCTCCTGGGCCTGG - Intergenic
1132798893 16:1741793-1741815 GAACCAGGGCCGGCTGGGACTGG - Intronic
1134208853 16:12259415-12259437 GAACTAGGGCTTGCTCAGGCTGG - Intronic
1134804578 16:17113701-17113723 CAGACAGGGCTTGCTGAGTTAGG + Intronic
1137599235 16:49744616-49744638 CAAACAGGCCTTGCTGTCACTGG - Intronic
1137638631 16:50009138-50009160 CACCCAGGGCATGCTGATGCAGG - Intergenic
1140198342 16:72874532-72874554 CAACAAGCGCTTGGTGAGAATGG + Intronic
1142503097 17:344944-344966 CCACCTGGCCTTGCTGAGAGAGG + Intronic
1142551758 17:745111-745133 CAAACAGGGCTTCCTGGGTCAGG + Exonic
1143190298 17:5035429-5035451 CACTCAGGACTTGCTGAGGCAGG + Exonic
1150208097 17:63424375-63424397 CAACCAGAGCTTGTTGGGGCAGG + Exonic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1155461052 18:26084018-26084040 GAACCAGGGCTTGGAGAAACGGG + Intronic
1155498714 18:26466270-26466292 GGCCCTGGGCTTGCTGAGACTGG + Intronic
1157063672 18:44321990-44322012 CAACCAGAGCCTGCTGAACCTGG - Intergenic
1157488558 18:48106926-48106948 CAGCCTGAGCTTGCTGAGCCTGG - Intronic
1158357883 18:56640540-56640562 TACCCAGGGCGGGCTGAGACAGG - Intronic
1160125439 18:76167501-76167523 CGTCCAGGGCTTGCTGAGGGTGG + Intergenic
1160949611 19:1659080-1659102 CAACCAGGAGTGGCGGAGACGGG - Intergenic
1163385932 19:17000578-17000600 CAACCTGGCCTTCCTGAGGCTGG - Intronic
1164592934 19:29516098-29516120 AAACCAGGGCTTTCTGTGGCTGG + Intergenic
1165814334 19:38632420-38632442 CATCCAGGGCTTGCTGTGATGGG - Exonic
1165899431 19:39161914-39161936 CAGGCAGGCCTTGCTGAGAAGGG - Intronic
1165994361 19:39833610-39833632 CCTCCTGGGCCTGCTGAGACCGG + Exonic
1166009875 19:39934449-39934471 CACCCCAGGCTAGCTGAGACAGG - Intronic
1166315303 19:41985986-41986008 TCACCAGGGCTTGCTGAGGTGGG + Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167515379 19:49920545-49920567 CAACCAGGGGGTGCTGGGAAGGG + Intronic
1168076051 19:53981549-53981571 CAGCCAGGGCTGGGTTAGACCGG + Intronic
1168713633 19:58515035-58515057 CCACCACGCCTGGCTGAGACAGG - Intronic
925085003 2:1100987-1101009 CAACCAAGGCTTGGTGAGTGTGG + Intronic
925153454 2:1633286-1633308 CAACCAGGGCCGGCTGGGAGCGG + Exonic
925233938 2:2261034-2261056 TAACCAAGACTTCCTGAGACAGG - Intronic
926142343 2:10375180-10375202 CAGCCAGGGCCTGCTGGGGCAGG - Intronic
926677414 2:15637889-15637911 CAATCTGGGCTTTCAGAGACAGG - Intergenic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928359947 2:30654876-30654898 CAACCAGGGCATTCTGAGACTGG + Intergenic
929612896 2:43284856-43284878 CATCCAGGGCATGCTGATGCAGG - Intronic
933241845 2:79930473-79930495 CAACCAGGCCTTGGTGCAACTGG + Intronic
933993007 2:87647125-87647147 CAACCAGAGCTTCCAGAAACTGG - Intergenic
934113531 2:88764433-88764455 CAACCAGGCCCTGCAGAGGCAGG + Intergenic
935314755 2:101820821-101820843 CGACCAGGGCTTGCTGTCATGGG - Intronic
936300850 2:111303754-111303776 CAACCAGAGCTTCCAGAAACTGG + Intergenic
937647776 2:124284921-124284943 CACCCAGGGTATTCTGAGACAGG + Intronic
939953819 2:148508127-148508149 CACCTAGGGTTTGCTGAGGCTGG - Intronic
943906170 2:193502826-193502848 CTTCCTGGGCTGGCTGAGACTGG - Intergenic
945242862 2:207692410-207692432 CTGCCAGGGCTTGCTGTGAATGG - Intergenic
1168978121 20:1983085-1983107 CCAGCAGGAATTGCTGAGACAGG - Exonic
1169026917 20:2379519-2379541 CATCCTGGGCTTGCTTGGACGGG - Intergenic
1171190833 20:23158157-23158179 CACCCAGGGCTGCCTGAGAATGG - Intergenic
1171394494 20:24823139-24823161 CACCCAGGGCATGCTGACAAAGG - Intergenic
1172213490 20:33217350-33217372 CCACCAGGGCTTGCTCACATTGG - Exonic
1172965250 20:38829785-38829807 CAAGCAGGGATTTCTCAGACGGG + Intronic
1173581691 20:44151609-44151631 CCAAGAGGGCTTGCAGAGACCGG + Intronic
1173981474 20:47227349-47227371 CAACCACGGCTGGCTGTGAGGGG + Intronic
1174760976 20:53207156-53207178 CAAACAGGGCAGGCTGAAACAGG - Intronic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1176998845 21:15587310-15587332 CAAACAGGCCTTGCTAAGATGGG + Intergenic
1178890031 21:36513554-36513576 CAAACAGGGCTTCCTGTGACTGG - Intronic
1179242739 21:39606502-39606524 TAACCAGTGCTTGGAGAGACTGG - Intronic
1179541475 21:42085811-42085833 CAACCTGGGAGTGCTGAGATGGG + Intronic
1179802521 21:43817557-43817579 GTACCAGGCCTTGCCGAGACTGG - Intergenic
1181973700 22:26713267-26713289 CTACCAGGGGAGGCTGAGACAGG - Intergenic
1184109902 22:42388579-42388601 CAAGCAGGGGTTGCTGAGGCAGG + Intronic
1184294019 22:43512530-43512552 CCACCTGGGCTTCCTGAGCCAGG - Intergenic
950628026 3:14262623-14262645 CCACCAGGGATTGCAGAGATTGG + Intergenic
952626918 3:35416786-35416808 CAATAAGGGCTTGCTGAGGCCGG - Intergenic
952898653 3:38095660-38095682 CACCCAGGCCCAGCTGAGACAGG + Intronic
953202802 3:40792505-40792527 CCACCAGGCCTTCATGAGACTGG - Intergenic
953271400 3:41448747-41448769 CTGCCAGGGCTTGATGAAACGGG + Intronic
953914617 3:46910265-46910287 CCACCTGGGCTTGCAGAGTCAGG - Intergenic
954717396 3:52533512-52533534 CTACCAGGACATGCGGAGACTGG - Exonic
961450087 3:126998756-126998778 CAGCCAGGGCTGCCTTAGACAGG - Intronic
961756038 3:129127958-129127980 CAACCAGGCCTGTCTGAGGCCGG + Intronic
962066641 3:131988293-131988315 AAAGCAGGGCTTGATGAGCCAGG + Intronic
964876428 3:161372758-161372780 AGAGCAGGGCTTGCTGAGAGTGG + Exonic
966914104 3:184575530-184575552 CAGCCTGGGCTTGTTGAGGCAGG - Intronic
966969512 3:185030357-185030379 AAACCAGGGGTTGCTCAGAGAGG - Intronic
968006732 3:195248090-195248112 CATCCAGTGCTCGCTGAGATTGG + Intronic
969458581 4:7315212-7315234 CAACCAGGGGCTGCAGAGGCTGG - Intronic
970136795 4:12933986-12934008 CAACCAGGGCCTTCTGAAAATGG + Intergenic
970827109 4:20289348-20289370 CAAGCTGGGCTTGCTGGCACTGG - Intronic
971162451 4:24147291-24147313 CAACAAGGGCTCAGTGAGACCGG + Intergenic
980757937 4:137190446-137190468 CACCCAGGGCATGCTGATGCAGG + Intergenic
982718589 4:158836201-158836223 CAGCCAGGCGTTGCTCAGACTGG + Intronic
983011246 4:162550445-162550467 CAACCAGGCCATACAGAGACAGG + Intergenic
983229761 4:165117149-165117171 CAAACAGGCCTTGCTGACCCTGG + Intronic
984248289 4:177301844-177301866 CAACCATGCCTTCCTGATACAGG - Intergenic
989235661 5:39145864-39145886 CAAGCAGGGGATGCTGAGAAGGG - Intronic
989394845 5:40943061-40943083 CAGCCAGGGCTTGCTAGGCCAGG - Intronic
990216778 5:53541884-53541906 CATCTAAGGCTTCCTGAGACAGG - Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
995928486 5:117406209-117406231 CTACCAGTACTTGCTGCGACTGG + Intergenic
997510297 5:134449382-134449404 CCACCTGGGCTTGCAGTGACAGG - Intergenic
998353609 5:141516614-141516636 CAGCCAGGGCTGGCTAAGTCGGG + Exonic
1002053253 5:176583944-176583966 CAAGCAGGGCTTCCTGAGGATGG + Intronic
1004392140 6:15218800-15218822 CAACCAGGGCTTACTCTGAAAGG - Intergenic
1005677704 6:28172573-28172595 CAACCAGCACTAGCTGAGAAGGG + Intergenic
1007663821 6:43502868-43502890 CAGCCTGGGCTTGCTGCCACTGG - Intronic
1011779315 6:90769298-90769320 CATACAGGGCTTGCTGAGTGGGG + Intergenic
1016989145 6:149917499-149917521 AAACCAGGCCATGCAGAGACAGG - Intronic
1018542773 6:164900789-164900811 CAACAAGGCCTTGTTGAAACAGG + Intergenic
1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG + Intergenic
1024571453 7:50726012-50726034 AAACCAGGGCTTGCAGATATTGG - Intronic
1024803774 7:53111734-53111756 CCACCTGGGCTACCTGAGACCGG + Intergenic
1031896307 7:127352524-127352546 CTACCAGAGCTTACTGACACTGG + Intronic
1035687330 8:1535123-1535145 CGGCCAGCACTTGCTGAGACAGG - Intronic
1040355874 8:46617686-46617708 CAACCAGCGCGTGCAGAGGCGGG + Intergenic
1041289627 8:56296685-56296707 CAAGCAGGGCTGCCTGAGAAAGG + Intergenic
1044051878 8:87515532-87515554 CATCCAGGGCACGCTGACACAGG - Intronic
1045443698 8:102239246-102239268 CAGGCGGGGCTTGCCGAGACAGG - Intergenic
1045931577 8:107633282-107633304 CATCCAGGTCATGCTGATACAGG - Intergenic
1050911538 9:11077741-11077763 CATACAGGGCTTCCTGAGACTGG + Intergenic
1052851369 9:33380423-33380445 CAACCAGTCCATGCTGGGACTGG + Intergenic
1058868103 9:109180089-109180111 CAAGCAGGGCTGGGTGAGAGAGG - Intronic
1060032806 9:120230083-120230105 CAACAAAGGCAGGCTGAGACAGG + Intergenic
1062521890 9:136961398-136961420 CCACCAGGGCCTGCAGGGACAGG + Intergenic
1187373394 X:18728791-18728813 AAACCAGAGGATGCTGAGACTGG + Intronic
1189041038 X:37542550-37542572 CACCCAGAGCCTCCTGAGACTGG - Intronic
1189041283 X:37543687-37543709 CACCCAGAGCCTCCTGAGACTGG - Intronic
1197891004 X:131270307-131270329 CTACAAGGGCTTTCTGAGCCTGG + Intergenic
1198271953 X:135063620-135063642 CAACCAGGGAAGGCTGTGACAGG + Intergenic
1199352881 X:146824434-146824456 AAACCAGGGCTTTGTGAGTCAGG + Intergenic
1199813475 X:151374670-151374692 CCACCTGGTATTGCTGAGACTGG + Intergenic
1202272958 Y:23088099-23088121 CAGCCAGGGCTTTCTGAGGCTGG + Intergenic
1202293068 Y:23332583-23332605 CAGCCAGGGCTTTCTGAGGCTGG - Intergenic
1202425955 Y:24721843-24721865 CAGCCAGGGCTTTCTGAGGCTGG + Intergenic
1202444834 Y:24948243-24948265 CAGCCAGGGCTTTCTGAGGCTGG - Intergenic