ID: 1122706975

View in Genome Browser
Species Human (GRCh38)
Location 14:103628102-103628124
Sequence CAGGGTTCACAAAGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122706963_1122706975 30 Left 1122706963 14:103628049-103628071 CCCTGGAAAAACCGAGGAGCACT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 181
1122706964_1122706975 29 Left 1122706964 14:103628050-103628072 CCTGGAAAAACCGAGGAGCACTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 181
1122706965_1122706975 19 Left 1122706965 14:103628060-103628082 CCGAGGAGCACTTGCTTCTCTGG 0: 1
1: 0
2: 3
3: 25
4: 242
Right 1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122706975 Original CRISPR CAGGGTTCACAAAGGGCTGC TGG Intronic
900185540 1:1331515-1331537 CCTGGTGCACACAGGGCTGCTGG - Exonic
900546093 1:3230065-3230087 CAGGGATCCCAGAGAGCTGCAGG - Intronic
902081618 1:13824828-13824850 CAGAGCTCACCATGGGCTGCAGG - Exonic
902661215 1:17905348-17905370 CAGGCTTCACAGAGGTCTGTTGG - Intergenic
903769795 1:25756694-25756716 CAGGATTCAAACAGGTCTGCTGG - Intronic
904459509 1:30667824-30667846 CAGGATTAACACAGGGTTGCTGG - Intergenic
904922067 1:34015575-34015597 CCTGGATCACAAAGGGCTGTAGG + Intronic
906222061 1:44088540-44088562 CAAGGCTGAGAAAGGGCTGCAGG - Intergenic
906322577 1:44826398-44826420 CAGGGCTCACAGAGGGCTCCTGG + Intronic
907671505 1:56478069-56478091 CAGGGGTCAGAAAGGGCTCTTGG + Intergenic
908863775 1:68521630-68521652 CAGAGTTCTCAAACAGCTGCTGG + Intergenic
910341605 1:86194613-86194635 CAGGCTCCACAAAGGACTGTTGG - Intergenic
911508122 1:98779200-98779222 CAGGTTTCTCAAAGGACTGTGGG - Intergenic
911894594 1:103415511-103415533 GAGGGTTCAAAAGGGGATGCAGG + Intergenic
915006025 1:152637399-152637421 CAGCATTCACAAATGGCTGCAGG + Intergenic
915018836 1:152760977-152760999 CTGGGTGCTCACAGGGCTGCAGG - Exonic
915594583 1:156888776-156888798 AAGGGCTCACAGAGGGCAGCTGG - Intergenic
916092038 1:161314890-161314912 CTGGGTTCCCAGCGGGCTGCTGG + Intronic
918611565 1:186498212-186498234 TAGGGTTCACAAGAGGCTCCTGG - Intergenic
919060559 1:192626951-192626973 GAGGGTTGGCAAAGAGCTGCAGG + Intergenic
922534252 1:226368169-226368191 AAGGGTTCAGAAGGGACTGCAGG - Intronic
923865804 1:237938330-237938352 CAGTGTTCTCAAAGTGCTGTTGG + Intergenic
924197844 1:241626959-241626981 CAGGGTTGACAAAGTGTAGCAGG - Intronic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
1063067084 10:2621045-2621067 CAGGCCACACAAAGGGCTGGGGG + Intergenic
1063510745 10:6642916-6642938 CAGGATTCACAATGGGGTGCAGG - Intergenic
1064306771 10:14174331-14174353 CAGGGTACACAGAGAGCTGTAGG - Intronic
1069737799 10:70669011-70669033 CAGTGTCCACAGAGGGCTGCTGG + Intergenic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1071393311 10:85196845-85196867 CAAGTATCACAAAGGGCTGCTGG - Intergenic
1072535424 10:96359258-96359280 CATTGTTTCCAAAGGGCTGCAGG - Exonic
1073185996 10:101615350-101615372 CAGGATCCACTAAGGGCTGGGGG + Intronic
1075637862 10:124042582-124042604 TAAGCTTCAGAAAGGGCTGCTGG + Intronic
1075782986 10:125028865-125028887 CAGAGTCCACAAAGGACTTCAGG + Intronic
1078434774 11:11315450-11315472 ATGGATTCTCAAAGGGCTGCTGG + Intronic
1079469481 11:20764755-20764777 CTGTGTTCACAAAAGGCTGAGGG + Intronic
1081932447 11:46881494-46881516 CAGGGGTGGGAAAGGGCTGCTGG - Intronic
1084407781 11:68987124-68987146 CAGAGTTCACACAGGGCTAGAGG - Intergenic
1087465458 11:98498638-98498660 AAAGATTCACAAAGGCCTGCAGG + Intergenic
1087961962 11:104363061-104363083 CAGGGAACAAAAAGGGCTGATGG - Intergenic
1091979666 12:4854855-4854877 CAGGGTTCAATCAGGGCTGTTGG - Intergenic
1093632991 12:21432118-21432140 CAGGGTCCACAATGGGCTTCTGG - Intergenic
1100464923 12:94836094-94836116 AAGGGGACAGAAAGGGCTGCTGG - Intergenic
1103415569 12:120739920-120739942 CAGACTTTACAAAGGGCTGAGGG - Exonic
1104771306 12:131366438-131366460 CAGGGTTCAGCAGGGGCTGAAGG - Intergenic
1104820933 12:131677264-131677286 CCGGGTGCACCCAGGGCTGCCGG + Intergenic
1105349563 13:19602739-19602761 CAGGGAACACAAACTGCTGCGGG - Intergenic
1106345542 13:28873369-28873391 CAGGGTTCAGAGAAGGCTTCAGG - Intronic
1108041718 13:46345503-46345525 CAGGATCAAGAAAGGGCTGCTGG - Exonic
1111600946 13:90473223-90473245 AAGAGTTCACAAAGGGCAGTTGG - Intergenic
1113748459 13:112762405-112762427 CAGTTCTCACAAAGGCCTGCAGG - Intronic
1115193991 14:30776886-30776908 CAGCGTTCTCAACCGGCTGCCGG + Intergenic
1115528295 14:34302772-34302794 CAGGGATCACAAAGGAGAGCAGG + Intronic
1115805230 14:37043442-37043464 GAGGGCTCACAGAGGACTGCAGG - Intronic
1117047237 14:51825758-51825780 CTGGTTTCCCAAAGGGTTGCTGG + Intergenic
1119872216 14:78027667-78027689 CTGGATTCACCAAGGGCTTCTGG + Intergenic
1121536668 14:94695655-94695677 CAGGGTTCCGGAAGGCCTGCTGG + Intergenic
1122672003 14:103379646-103379668 CAGGGCTCACAGAGGGCAACAGG + Intergenic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1123405813 15:20018843-20018865 CATCCTTCACACAGGGCTGCTGG + Intergenic
1123515143 15:21025491-21025513 CATCCTTCACACAGGGCTGCTGG + Intergenic
1126165199 15:45649058-45649080 CAGAGTTCAAACAGAGCTGCTGG - Intronic
1127270538 15:57397338-57397360 CAGCCTCCACAAAGGCCTGCGGG - Intronic
1128089985 15:64912687-64912709 CAGGATTCAGCCAGGGCTGCAGG - Intronic
1128635967 15:69302625-69302647 CAGGGGTCACACAGGGTTCCTGG - Intronic
1131511869 15:93053653-93053675 CTGGGTTCACACAAGGCTGCTGG - Intronic
1132699084 16:1214650-1214672 CGGGGTGCACAGACGGCTGCAGG + Intronic
1133725534 16:8533988-8534010 CAGGCTTCACAAAGAGGTACTGG - Intergenic
1134434826 16:14246927-14246949 CAGGTTTGACAGAGTGCTGCTGG - Exonic
1136571450 16:31099803-31099825 CTGGCTTCCCAAAGTGCTGCTGG + Intergenic
1138266242 16:55661851-55661873 AAGGGCTCCCAAAGGGCTGGGGG - Intronic
1138961691 16:62036115-62036137 CCAGGTTCACAAATGGCTGGAGG + Exonic
1139614844 16:68082708-68082730 CAGGGCTCTCAGAGGGCTGAAGG + Intergenic
1140861909 16:79025526-79025548 CAGGGAGCACTGAGGGCTGCTGG + Intronic
1142135597 16:88450621-88450643 TGGGGTTCACAATGGGCAGCAGG + Intergenic
1142177926 16:88653389-88653411 CAGGTTTCTGAAGGGGCTGCAGG - Exonic
1143389004 17:6549196-6549218 CAGGGCTGGCAAGGGGCTGCGGG - Intronic
1144088106 17:11828777-11828799 CAGAGTTTAGAAAGGGCTTCTGG - Intronic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1147419091 17:40313202-40313224 GAGGGCTCACAAAGGGCTCTGGG - Intronic
1147567537 17:41547030-41547052 CAGGGATCACAAAGGCCTGAAGG - Intergenic
1148236722 17:45974124-45974146 CAGCGTTTACACAGGGCTGCCGG + Intronic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1152771371 17:82171551-82171573 GAGGGAGCACAAGGGGCTGCTGG + Intronic
1156869628 18:41930697-41930719 CATGGCACACATAGGGCTGCTGG + Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1161707137 19:5827494-5827516 CAGGGTTCAGAAAGGGGTTTTGG + Intronic
1163055189 19:14712653-14712675 CAAGGAGCACCAAGGGCTGCAGG - Intronic
1163398876 19:17079755-17079777 CCGGGCACACAAAGGGCTGGTGG - Intronic
1163492946 19:17627677-17627699 AAGGGATCCCAAGGGGCTGCAGG + Intronic
1163848531 19:19650782-19650804 CAGTGTTGCCACAGGGCTGCTGG - Intronic
1164854960 19:31513543-31513565 CCGGGGCCTCAAAGGGCTGCTGG + Intergenic
1165139423 19:33689923-33689945 CTGGAGTCACAGAGGGCTGCTGG + Intronic
1166275359 19:41749908-41749930 CAGGGTTTATAAAGCACTGCAGG - Intronic
1166280383 19:41788705-41788727 CAGGGTTTATAAAGCACTGCAGG - Intergenic
1168451518 19:56470128-56470150 AAGGGAGGACAAAGGGCTGCTGG + Intronic
1168723782 19:58569819-58569841 CATGGTTCACATACGGCTACAGG - Intronic
925178032 2:1798516-1798538 CAGAGATGACACAGGGCTGCAGG - Intronic
925201361 2:1969733-1969755 CAGTGTCCAGAGAGGGCTGCAGG - Intronic
925377344 2:3397369-3397391 CAGAGCTCACACAGGGCTGAAGG - Intronic
925377356 2:3397441-3397463 CAGAGCTCACACAGGGCTGTGGG - Intronic
925818563 2:7777192-7777214 CAGTGCTCACAAATGGCTGGTGG + Intergenic
926586777 2:14695426-14695448 GAGAGTTCACAAAGAGCTCCTGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
931464373 2:62473794-62473816 AAGGGATCACAGAGGGATGCTGG + Intergenic
932566694 2:72915611-72915633 CAAGGTTCCCACAGGGATGCGGG - Intergenic
932779252 2:74549637-74549659 CAGGGTTCCTTAAGGGCGGCGGG - Intronic
932885641 2:75546940-75546962 CAGGGTTCTCCAATGGCTTCTGG - Intronic
933835824 2:86244754-86244776 GAGGGTTAACAAAGGGCTTGGGG + Intronic
934968724 2:98745799-98745821 CAGGGTTGATAAAGGCCTGTGGG + Intergenic
937046071 2:118852729-118852751 CAGGATTCAGAAAGCGCTCCTGG + Intergenic
937992924 2:127674319-127674341 TAGGTTCCAGAAAGGGCTGCAGG + Intronic
938804087 2:134789705-134789727 CAGGGTTCACTGAGGGCTGTTGG + Intergenic
940843643 2:158615352-158615374 CAGGCTTCATAAATGGCTGAGGG - Intronic
946176708 2:217926848-217926870 CAGGGCTCACCCAGGTCTGCTGG + Intronic
1169080671 20:2796273-2796295 CAGGGTTCATGGAGGGCAGCAGG + Exonic
1169638356 20:7720362-7720384 AAGGGTTAAGAAAGGGCAGCAGG + Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172798976 20:37563330-37563352 CAGGGTTCACAAAAGTGTCCAGG - Intergenic
1173601255 20:44296965-44296987 CAGGGTTCACTAGGGGATGAGGG - Intergenic
1174117603 20:48237970-48237992 GAGGGTTCTCAAGGGGCTGGGGG - Intergenic
1175266693 20:57707899-57707921 CTGAGTTCACAAAGGGCCTCTGG + Intronic
1175771080 20:61624742-61624764 CCAGGTTTACAAAGAGCTGCAGG + Intronic
1177264766 21:18768055-18768077 CAGGCTTAACAAAGGGTTACAGG + Intergenic
1177877346 21:26649722-26649744 CAGACCTCACAAAGGGCTACAGG + Intergenic
1178257515 21:31067875-31067897 CAGAGTTCACAAAGGAATGTGGG - Intergenic
1179594970 21:42437380-42437402 CAGGGTCCTCAAAGGGCCCCGGG - Intronic
1180782278 22:18528043-18528065 CAGGCGTCACAATGGGCGGCAGG - Exonic
1181125828 22:20702069-20702091 CAGGCGTCACAATGGGCGGCAGG - Intergenic
1181239166 22:21467381-21467403 CAGGCGTCACAATGGGCGGCAGG - Intergenic
1181323533 22:22026545-22026567 CAGTGCTCACACAGTGCTGCAGG + Intergenic
1181522721 22:23458777-23458799 GAGGGTTCCCAGAGGGCTGCCGG + Intergenic
1183429382 22:37756497-37756519 CAGAGTTCACAAAGTGCTCTGGG - Intronic
1183689029 22:39377711-39377733 CAGGGGTGATACAGGGCTGCCGG - Intronic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1185162635 22:49239005-49239027 CGGGGTTCACAAATGGCTAATGG + Intergenic
1185231617 22:49687136-49687158 CAGGGCTCACCCAGGTCTGCAGG - Intergenic
949563142 3:5221110-5221132 CAGCGTTCATACAGGACTGCTGG - Intergenic
951907288 3:27717681-27717703 AAGTGTTGACAAAGGGCTCCGGG + Exonic
951962857 3:28348691-28348713 CAGGGGTCACCACGGGCTTCCGG + Exonic
957377917 3:79383046-79383068 AAGAGTTCTCAATGGGCTGCTGG + Intronic
963969750 3:151416410-151416432 CAGGCCTTACCAAGGGCTGCTGG - Exonic
964749526 3:160041467-160041489 CATAGCTCACACAGGGCTGCTGG + Intergenic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
968507373 4:977108-977130 CAAGGATCACCGAGGGCTGCTGG + Intronic
968607985 4:1544591-1544613 CAAGGATCACCGAGGGCTGCTGG + Intergenic
969674186 4:8606137-8606159 CAGGGTTCATGGAGGGCAGCAGG - Exonic
969846956 4:9926908-9926930 CAGGGAGCACCAAGGACTGCTGG + Intronic
970410189 4:15798441-15798463 GAGGGTTGAAAGAGGGCTGCTGG - Intronic
970581936 4:17481594-17481616 CAGGGTGCATGAAGTGCTGCTGG - Intronic
973745826 4:53962621-53962643 CAGGGTTCAGGCAGGTCTGCAGG - Intronic
982019932 4:151192699-151192721 CAGCGTTCACAAAGGCTTGTAGG - Intronic
984237482 4:177177974-177177996 CAGGGTTAACAAAGGAATTCAGG - Intergenic
985999614 5:3620246-3620268 CTGGGTTCACAGATGGCTGGCGG - Intergenic
989589836 5:43103067-43103089 GAGAGTTCAAAAAGGGCAGCTGG + Intronic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
995474776 5:112536838-112536860 CAGAGTCTACAAAGGGCTGCAGG + Intergenic
996017194 5:118552859-118552881 CAGGATTCACTAATGGCTTCTGG - Intergenic
997331080 5:133062309-133062331 AAGGTTTGAAAAAGGGCTGCAGG + Intronic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
1000003995 5:157166297-157166319 CACAGGTCACAAAGGACTGCAGG - Intronic
1001410015 5:171504815-171504837 GAGGGGGGACAAAGGGCTGCAGG + Intergenic
1003141823 6:3478130-3478152 GGGGATTCACAAAGGGCTCCAGG - Intergenic
1005496296 6:26391006-26391028 CAGGGTTCATTAAGAGCTGCTGG - Intronic
1006940250 6:37747363-37747385 GAGAGTTCAGAAAGGGATGCTGG + Intergenic
1007113244 6:39325789-39325811 CAGGGTGGACAAAAGCCTGCAGG - Intergenic
1008731057 6:54483108-54483130 CAAGGAACACAAAGGGTTGCTGG + Intergenic
1013418234 6:109943706-109943728 CTGGGTTTACAAAGTGCTGCAGG + Intergenic
1019271413 7:151096-151118 CTGGGTCCAGGAAGGGCTGCAGG + Intergenic
1019588604 7:1817760-1817782 GAGGGTTCCCAGAGGGCTGCCGG - Intronic
1019732444 7:2635409-2635431 ACGGGGTCACAAAGGGCTGGTGG - Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1021860564 7:24901731-24901753 CAGGGTTGACAAGGTGCTTCTGG + Intronic
1023704947 7:42931876-42931898 CGGGGTTAACATGGGGCTGCGGG - Intronic
1024538279 7:50456627-50456649 AAGAGTGCACAAAGTGCTGCTGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1035172160 7:157022799-157022821 CAGGGTGGACCAGGGGCTGCTGG - Intergenic
1035452847 7:158989607-158989629 CAGGGTTCACAAAGAACAGTGGG + Intergenic
1035714727 8:1745037-1745059 CAGCGTTCACCAAGTGCTACCGG - Intergenic
1040886532 8:52269384-52269406 CAGGCTTCAGAAAGATCTGCAGG + Intronic
1047878694 8:129169100-129169122 AAGGATTCACAAAGGCCTGCTGG + Intergenic
1048910980 8:139134823-139134845 CAGGGTTCACACAGGTTTGCAGG + Intergenic
1050062721 9:1727291-1727313 CAGGGTGCACAATGGGCTCAAGG + Intergenic
1050070117 9:1801608-1801630 CAAGGAACACAAAGGGTTGCTGG - Intergenic
1052915852 9:33923878-33923900 CAGGATTCACGAAGGGCTGCTGG + Exonic
1053008044 9:34617116-34617138 CAGAGTTCCCAAAGGGCTCTTGG - Intronic
1053419796 9:37970111-37970133 CAGGTTCCACCACGGGCTGCTGG - Intronic
1055017550 9:71634776-71634798 GAGGGATAACAAAGGGCTTCAGG + Intergenic
1059551006 9:115228805-115228827 CAGGGCTCACAAAGTGATGAAGG - Intronic
1060434117 9:123578761-123578783 CAAGGTACACAAGGGGCTGTGGG + Intronic
1060799278 9:126533367-126533389 GGGGGTTCACAGAGGCCTGCGGG - Intergenic
1061379461 9:130245301-130245323 CACGTTTCTCATAGGGCTGCTGG + Intergenic
1061683883 9:132259231-132259253 CATGCTTCTCAAAGGGCTGGAGG - Intergenic
1062205103 9:135331978-135332000 AAGGGATGACAAAGGACTGCAGG + Intergenic
1062338029 9:136081058-136081080 CACGGATCACGAACGGCTGCGGG + Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1185715030 X:2334838-2334860 CAGGGTTCACAAAGGCTTGGAGG - Intronic
1187933950 X:24318090-24318112 CAGGGATCACAAAGGGAAGCTGG + Intergenic
1188989865 X:36804455-36804477 CAGGGCTCGCAAAGGACTTCAGG - Intergenic
1195616447 X:106916298-106916320 CAGGGTCCACAAAGAGTTCCAGG + Intronic
1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG + Intronic
1197840178 X:130737889-130737911 AAAGGTTCACAAGGGGCTGGAGG + Intronic