ID: 1122706975

View in Genome Browser
Species Human (GRCh38)
Location 14:103628102-103628124
Sequence CAGGGTTCACAAAGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122706965_1122706975 19 Left 1122706965 14:103628060-103628082 CCGAGGAGCACTTGCTTCTCTGG 0: 1
1: 0
2: 3
3: 25
4: 242
Right 1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 181
1122706963_1122706975 30 Left 1122706963 14:103628049-103628071 CCCTGGAAAAACCGAGGAGCACT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 181
1122706964_1122706975 29 Left 1122706964 14:103628050-103628072 CCTGGAAAAACCGAGGAGCACTT 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122706975 Original CRISPR CAGGGTTCACAAAGGGCTGC TGG Intronic